rmfi Revista mexicana de fitopatología Rev. mex. fitopatol 0185-3309 2007-8080 Sociedad Mexicana de Fitopatología A.C. 10.18781/R.MEX.FIT.2023-2 Artículo Científico Viroma del nopal verdura en la zona centro de México Ortega-Acosta Candelario * 1 Ochoa-Martínez Daniel L. 1 Rojas-Martínez Reyna I. 1 Nava-Díaz Cristian 1 Valverde Rodrigo A. 2 Fitosanidad Fitopatología, Colegio de Postgraduados. 56264. Km 36.5 Carretera México-Texcoco, Montecillo, Estado de México, México; Colegio de Postgraduados Colegio de Postgraduados Estado de México Mexico Department of Plant Pathology and Crop Physiology, Louisiana State University Agricultural Center, Baton Rouge, LA, 70803, USA. Louisiana State University Agricultural Center Louisiana State University Agricultural Center 70803 USA Autor de correspondencia: Daniel L. Ochoa-Martínez ldaniel@colpos.mx 15 11 2023 2023 41 4 RMEXFIT20232 31 07 2023 15 11 2023 Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons Resumen Objetivo/Antecedentes

. En este estudio se aprovechó la capacidad de la secuenciación de alto rendimiento (HTS) para detectar virus en nopal verdura.

Materiales y Métodos.

Se analizaron muestras del Estado de México (EDMX), Hidalgo y Morelos, así como de la Ciudad de México (CDMX).

Resultados

. En la muestra proveniente de EDMX, se detectaron y recuperaron los genomas de Opuntia virus 2 (OV2, género Tobamovirus) y Cactus carlavirus 1 (CCV-1, género Carlavirus). En la muestra proveniente de CDMX, además de OV2 y CCV-1, se detectó un nuevo viroide y un potexvirus. El primero tiene un genoma RNA circular con 412 nt de longitud para el cual se propone el nombre de “Opuntia viroid I” (OVd-I). La estructura primaria de este viroide mostró una identidad de secuencia de nucleótidos de menos del 80 % con cualquiera de los viroides actualmente conocidos y una relación filogenética con el género Apscaviroid, (Familia Pospiviroidae) con el que comparte motivos estructurales conservados.

Conclusión

. El nuevo potexvirus se denominó Opuntia potexvirus A (OPV-A), cuya secuencia de la replicasa viral tiene un 77.7 % de identidad de aminoácidos con Schlumbergera virus X. Finalmente, en 93 (72 %) de 129 muestras de nopal verdura recolectadas en las cuatro entidades, se detectó al CCV-1.

Palabras claves: Cactáceas HTS Viroide Potexvirus Tobamovirus Carlavirus.

Opuntia ficus-indica es la cactácea de mayor importancia económica en el mundo, se cultiva en América, África, Asia, Europa y Oceanía (Barbera et al.,1992). Esta especie fue domesticada en México (Griffith, 2004), donde se encuentra la mayor diversidad de cultivares (Bravo 1978), y de la cual se utilizan sus frutos y cladodios, dependiendo del cultivar. En México existen aproximadamente 12,618 ha dedicadas para la producción de nopal verdura para consumo humano (SIAP, 2022). Las principales entidades productoras de nopal verdura son Morelos y Ciudad de México, que en conjunto comprenden el 50 % de la superficie total cultivada. De los cladodios se obtienen diversos productos y subproductos que se utilizan para elaborar preparaciones antidiabéticas, sus flores son empleadas para preparar bebidas diuréticas, los frutos son usados para preparar jugos, jaleas, miel, mermeladas y pastas, entre otros, y de sus semillas se extrae aceite; además, esta cactácea también se cultiva como hospedante de la “grana cochinilla” (Dactylopius coccus), insecto utilizado para la producción del tinte de ácido carmínico (Barbera et al., 1992).

A nivel mundial se han identificado diferentes virus en cactáceas, la mayoría poseen genoma ARN monocatenario (Sastry et al., 2019). Además, se han descrito dos caulimovirus que infectan Epiphyllum spp. (Lan et al., 2019; Zheng et al., 2020) y tres geminivirus en varias especies de cactus (Fontenele et al., 2020; 2021). En México, en los municipios de Axapusco, Otumba y San Martín de las Pirámides (Estado de México), se reportó al tobamovirus Rattail cactus necrosisassociated virus (RCNaV) en plantas de nopal que mostraban manchas pequeñas y anillos amarillos en los cladodios (De La Torre-Almaraz et al., 2016a). En esa misma zona, también se encontró un potexvirus Schlumbergera virus X (SchVX) en plantas de nopal que presentaban manchas irregulares y deformación de cladodios (De La Torre-Almaraz et al., 2016a). Además, en cladodios de nopal verdura que mostraban síntomas de halos cloróticos y manchas irregulares, se detectaron un tobamovirus y un potexvirus en las localidades de San Martín de las pirámides (Estado de México) y Cuautepec de Hinojosa (Hidalgo), respectivamente, de los cuales no se pudo determinar la especie (De La Torre-Almaraz et al., 2007; AlonsoBarrera et al., 2015). Por último, un tobamovirus, denominado Opuntia virus 2 (OV2), se detectó con secuenciación de alto rendimiento (HTS, high-throughput sequencing) en especies del género Opuntia (Salgado-Ortíz et al., 2020) en México.

Otros patógenos de plantas importantes son los viroides, pequeñas moléculas de ARN circular monocatenario de aproximadamente 400 nucleótidos (nt) de longitud que pueden replicarse de forma autónoma. A diferencia de los virus, no hay evidencia que los viroides codifiquen alguna proteína y que sus genomas estén protegidos por una cápside (Di Serio et al., 2014). Taxonómicamente, los viroides se dividen en dos familias: a) Pospiviroidae, que incluye cinco géneros (Apscaviroid, Cocadviroid, Coleviroid, Hostuviroid y Pospiviroid) y b) Avsunviroidae que incluye tres géneros (Avsunviroid, Pelamoviroid y Elaviroid) (Di Serio et al., 2018; 2021). Algunos viroides pueden afectar severamente la producción de diversos cultivos, mientras que otros se replican sin provocar síntomas en plantas susceptibles (Di Serio et al., 2014).

Los avances en el campo de la secuenciación han hecho que las tecnologías basadas en HTS sean más asequibles a un mayor número de usuarios (Vučurović et al., 2021). El empleo de HTS ha revolucionado la virología vegetal y acelerado el descubrimiento de nuevas especies de virus en los ecosistemas, ampliando nuestro conocimiento de la diversidad de estos fitopatógenos (Fontenele et al., 2020; Vučurović et al., 2021). Por lo anterior, el objetivo de este estudio fue conocer el viroma del nopal verdura y determinar la distribución de Cactus carlavirus 1 (CCV-1) en cuatro estados productores de nopal verdura en México.

Materiales y Métodos

Secuenciación de alto rendimiento (HTS). Dos muestras que mostraban síntomas putativos a virus, denominadas CDMX-1 y EM-1 se sometieron a HTS. CDMX1 estuvo conformada con cladodios (n=4) que presentaban patrones amarillos irregulares, anillos amarillos y mosaico, procedentes de la alcaldía Milpa Alta de la Ciudad de México (Figura 1A-D); la muestra EM-1 (n=1) fue una planta proveniente de Oxtotipac, Municipio de Otumba, con manchas cloróticas alrededor de las espinas, este síntoma se denomina localmente por los productores “pinto” (Figura 1E). En ambos casos, se extrajo ARN con el kit SV Total RNA Isolation System (Promega, USA), siguiendo las instrucciones del fabricante. La muestra EM-1 se envió a Macrogen Inc. (Corea) en donde se preparó la librería usando TruSeq stranded total ARN, tratado previamente con Ribo-Zero Plant. La secuenciación se realizó en un equipo Illumina NovaSeq6000, con 150-bp PE. La muestra CDMX-1 se envió a BGI Genomics (China), donde se construyó la librería Eukaryotic Strand-specific mRNA y la secuenciación se realizó en la plataforma DNBSEQ, con 150-bp PE.

Análisis bioinformático. Los adaptadores y las secuencias de baja calidad de los datos obtenidos de Macrogen fueron removidos usando Fastp (Chen et al., 2018). Por su parte, las secuencias de BGI, se recibieron limpias y sin adaptadores, por lo cual se verificaron en FastQC (Andrews, 2010). Las lecturas limpias fueron ensambladas de novo con el software SPAdes (Prjibelski et al., 2020). Los contigs obtenidos fueron sometidos a una búsqueda BLASTx y BLASTn en una base de datos local de virus/viroides. Posteriormente, la lista reducida de hits virales se comparó con la base de datos completa no redundante (nr) del GenBank utilizando BLASTx y BLASTn (Vučurović et al., 2021).

Síntomas asociados a virosis en cladodios de nopal verdura. (A-D) Muestras de nopal colectadas en la Ciudad de México, Alcaldía Milpa Alta, (E) Muestra de nopal colectado en el estado de México, Municipio de Otumba, (F) Muestra de nopal sana del Estado de México.

Para la reconstrucción de los genomas, se utilizó Bowtie2 (Langmead y Salzberg, 2012), Samstools (Li et al., 2009) e Integrative Genomic Viewer (IGV) versión 2.3 (Thorvaldsdóttir et al., 2013). Las características del ensamble de los genomas obtenidos se obtuvieron en Qualimap (Okonechnikov et al., 2016), donde se calculó la cobertura promedio por nucleótido de cada genoma. Finalmente, los genomas obtenidos se anotaron con ORFinder del Centro Nacional para la Información Biotecnológica (por sus siglas en inglés, NCBI) y se depositaron en el GenBank.

Análisis filogenético. Los genomas obtenidos se alinearon con especies representativas del género Tobamovirus obtenidas en la base de datos del NCBI. Se utilizó el modelo GTR+F+R5 de sustituciones de nucleótidos. Por otro lado, se elaboró un árbol filogenético alineando secuencias de genomas completos de miembros representativos del género Carlavirus (familia: Betaflexiviridae), obtenidos del NCBI, así como un aislamiento del virus obtenido en este estudio. El modelo evolutivo estimado fue GTR+F+R5. Para el caso de nuevos virus, se construyeron dos árboles filogenéticos alineando secuencias de aminoácidos de la replicasa viral y de la cápside proteica pertenecientes a diferentes especies de la familia correspondiente obtenidas del ICTV (Kreuze et al., 2020) y la secuencia obtenida en este estudio. El modelo evolutivo para la replicasa viral fue LG+F+R7 y para la cápside proteica LG+F+R5. Para el análisis filogenético del nuevo viroide, se utilizaron secuencias de especies representativas de ambas familias de estos patógenos obtenidas del NCBI y el modelo evolutivo utilizado fue HKY+F+G4.

En todos los casos, los árboles se generaron con el método de Máxima Verosimilitud utilizando IQTREE 2 (Minh et al., 2020), el alineamiento múltiple de secuencias en MAFFT (Katoh et al., 2019), y el modelo evolutivo según el Criterio de Información Bayesiano implementado en ModelFinder (Kalyaanamoorthy et al., 2017). El soporte nodal se estimó con el bootstrap ultrarrápido (UFBoot) ejecutando un total de 1000 réplicas. Finalmente, la visualización y edición de los árboles se realizó en iTOL (Letunic y Bork, 2021).

Análisis de identidad por pares. Para reforzar la clasificación de las nuevas especies, se estimó la identidad por pares con SDT v1.2 (Muhire et al., 2014) comparando la replicasa y cápside proteica de los virus más cercanos, así como de diferentes genomas de la familia Pospiviroidae para el caso del viroide.

Predicción de estructura secundaria del nuevo viroide. Se obtuvo utilizando el servidor web UNAFold (www.mfold.org consultada el 18 de noviembre de 2022) (Zuker, 2003).

Validación de la detección de los nuevos virus y viroide. Parte del ARN extraído de los cladodios con síntomas que se envió a HTS, se sometió a RT-PCR para confirmar la presencia del viroide y virus encontrados. Se diseñaron diferentes iniciadores (Cuadro 1) a partir de las secuencias obtenidas. Adicionalmente, se realizaron análisis de RT-PCR para la detección de uno de los virus en cuatro muestras independientes recolectadas en la Ciudad de México (n=1, asintomática), Estado de México (n=2), Hidalgo (n=2) y Morelos (n=2).

En todos los casos, la síntesis de cADN se realizó con la enzima M-MLV Reverse Transcriptase (200 U μL -1) (Promega, USA) a partir de 1 μL de ARN total y 1 μL (10 mΜ) del iniciador antisentido, siguiendo las instrucciones del fabricante. El cADN obtenido se utilizó como cadena molde para la PCR cuya mezcla consistió en 2 μL de amortiguador de reacción (5X Green GoTaq®), 0.6 μL de MgCl2 (25 mM), 0.2 μL de dNTPs Mix (10 mM), 0.6 μL (10 μM) de cada iniciador, (sentido y antisentido) 4.9 μL de agua ultrapura, 0.1 μL de GoTaq® DNA Polymerase (5 U μL -1) (Promega, USA) y 1 μL de cDNA en un volumen final de 10 μL. Las

Iniciadores utilizados en los ensayos de RT-PCR para la validación de los virus/viroide detectados en los datos de HTS de las dos bibliotecas de nopal.
Nombre del iniciador Virus/Viroide (Región) Secuencia (5'->3') Amplicón (pb) Temperatura de alineamiento (°C)
OV2-F Opuntia virus 2 (Proteína de movimiento) CGG GTC CTT TTC CTT TTG TCT GTC 667 55
OV2-R GAGAGCGAGTAGAAACTCCAACG
CCV1-F Cactus carlavirus 1 (Replicasa viral) GAAGCGCATGGGCTGTATTG 459 55
CCV1-R GTCTGCGCAGCTTTAGCATC
Opuntia_Potex-F(RdRp) Opuntia potexvirus A (Replicasa viral) ACCCACTAGCCATTGAAGCC 580 55
Opuntia_Potex-R(RdRp) AGGTGGTTGGCACCTTTTGA
Caulimovirus_F Caulimovirus (Retro transcriptasa) TCCTCACACTAGTCCTGCCT 846 55
Caulimovirus_R TTGAGGACGGCACTCCAATG
Alphavirus-F(RdRp) Alphavirus (Cápside) CACTGGCGTGTTTTAGCCAC 579 55
Alphavirus-R(RdRp) TCAGCCTCCAGCCACAAAAT
Tymovirus-F Timovirus (Proteína del triple bloque de genes) CTGGAGCGCCTTGGAACTAA 745 55
Tymovirus-R TTTGCCAACCCTCACCATGA
Vityvirus-F Vityvirus (Proteína de movimiento) GAACTGCTTGATATGCGCCG 229 55
Vityvirus-R CCTGACGGACCACACTCATC
Banmivirus_Opun-F Banmivirus (Replicasa viral) CAGAGCGCCAATTAACCTGC 707 55
Banmivirus_Opun-R CGCTCTTGAAGGTTAGCCCA
OPV-I-1F Opuntia viroid I (Parte del genoma) TTGACCTAGGTTGGCTCTCG 362 55
OPV-I-1R GCAGGAGAAGGCCAGGAAG
OPV-I-2F Opuntia viroid I (Parte del genoma) GGGATCAACCTTGTGGTTCCT 351 55
OPV-I-2R GAAAGAAAAGCACCTGTGGGC

condiciones de PCR incluyeron una incubación inicial a 95 °C durante 3 min, seguida de 35 ciclos de desnaturalización a 95 °C durante 30 s, alineamiento a 55

°C durante 30 s, extensión a 72 °C durante 40 s y un ciclo de extensión final a 72

°C durante 10 min. Los productos de PCR se secuenciaron por el método Sanger en Macrogen Inc.

Detección de CCV-1. Se analizaron mediante RT-PCR 129 muestras provenientes de cladodios recolectados del Estado de México, Hidalgo, Morelos y Ciudad de México para la detección de CCV-1 con los oligonucleótidos CCV1-F/R con la finalidad de conocer su presencia o ausencia.

Microscopía electrónica de transmisión. Con el propósito de conocer si se encontraban viriones de los virus determinados en los resultados de HTS, plantas de nopal sintomático fueron utilizadas para preparar rejillas de cobre de 300 mallas cubiertas con Formvar para su observación. Para esto, se realizó la técnica “leaf dip” y se utilizó ácido fosfotúngstico 2 % como contrastante. Las rejillas se observaron en un microscopio electrónico de transmisión FEI Tecnai G2 Spirit TWIN, de la Unidad de Microscopía Electrónica del Colegio de Postgraduados.

 Resultados

Detección de virus por HTS. Se obtuvieron 32,921,232 lecturas en la muestra EM-1 y 48,292,940 lecturas para la muestra CDMX-1. Las lecturas sin procesar se depositaron en el NCBI con el número de bio-proyecto PRJNA922236. El análisis de estas lecturas mostró la presencia de secuencias de diferentes virus y un viroide en nopal ((Cuadro 2), los cuales se describen a continuación:

Comparación del genoma completo o parcial de los virus encontrados por HTS en las dos bibliotecas de nopal, con la secuencia de referencia más similar del GenBank.
Muestra Aislamiento de Virus detectado/Viroide Número de acceso GenBank Parte del genoma Número de acceso de la secuencia de referencia Porcentaje de similitud de nucleótido
EM-1 CCV-1-Edo-MeX OQ240442 Completo KU854930.4 87.71
OV2-Edo-Mex OQ240440 Completo NC_040685.2 97.67
CCV-1-CD-MX OQ240444 Parcial KU854930.4 97.5
CDMX-1 OV2-CDMX OQ240441 Completo NC_040685.2 97.61
Opuntia virus A OQ240443 Completo LC654699.2 74.42
Opuntia viroid I OQ240445 Completo X95292.1 88.52*

*Cobertura de consulta 14%

Opuntia virus 2. Se detectó y confirmó su presencia en las dos muestras sometidas a HTS, obteniendo dos genomas completos denominados OV2-Edo-Mex y OV2CDMX; la cobertura promedio por nucleótido fue de 634,104.1X y 500.5X, respectivamente (Figura 2A, 3A). El genoma OV2-Edo-Mex de 6,453 nt tiene la organización típica de los tobamovirus (Figura 2B) con una región no traducible (UTR) 5’ (nt 1-57), un marco de lectura abierto (ORF) que codifica la replicasa viral (RdRp) de 183 kDa (nt 58 -4,854), metiltransferasa/helicasa de 128 kDa (nt 67-3,360), una proteína de movimiento (MP) (nt 4,844-5,608), cubierta proteica (CP) (nt 5,514-6,167) y la UTR 3’ (nt 6,168-6,453). El genoma de OV2-Edo-Mex tiene una identidad de nucleótidos del 97.6 % con el aislamiento NC_040685.2 de OV2 (Cuadro 2).

El genoma del aislamiento OV2-CDMX tuvo una longitud de 6,453 nt, con una organización típica de tobamovirus (Figura 3B) consistente en una región 5’ no traducible (nt 1-61), un ORF que codifica la RdRp de 183 kDa (nt 62-4,858), metiltransferasa/helicasa de 128 kDa (nt 62-3,364), MP (nt 4,848-5,612) y CP (nt 5,632-6,171) así como una UTR 3’ (nt 6,172-6,453). La secuencia del genoma de este aislamiento compartió una identidad de nucleótidos del 97.61% con el aislamiento NC_040685.2 de OV2 (Cuadro 2). El análisis filogenético ubicó a ambos

(A) Cobertura de lecturas a lo largo del genoma del aislamiento OV2-Edo-Mex y porcentaje del contenido de guanina citosina, (B) Mapa genómico del OV2-Edo-Mex. La flecha indica el sitio del codón de terminación de la proteína de 128 kDa completa, con fugas de lectura.

(A) Cobertura de lecturas a lo largo del genoma del aislamiento OV2-CDMX y porcentaje del contenido de guanina citosina (B) Mapa genómico de OV2-CDMX. La flecha indica el sitio del codón de terminación de la proteína de 128 kDa completa, con fugas de lectura.

aislamientos de OV2 obtenidos en este estudio, en el subgrupo de tobamovirus que infectan cactáceas (Figura 4).

Árbol filogenético de Máxima Verosimilitud del género <italic>Tobamovirus</italic> que muestra las relaciones entre los genomas obtenidas en este estudio (en negrita) del OV2 y la de aislamientos previamente reportados. Los diferentes colores representan las familias botánicas como hospedantes naturales donde se ha reportado cada virus. Los círculos en las ramas muestran valores de soporte UFBoot > 70%.

Cactus carlavirus 1 (CCV-1). Este virus se detectó en las dos muestras que se sometieron a HTS. Sin embargo, el genoma completo solo se recuperó en la muestra del Estado de México. El genoma obtenido estuvo soportado por una cobertura promedio por nucleótido de 15,516X (Figura 5A). La organización del genoma de CCV-1 es similar a la de otros carlavirus conocidos, con seis ORFs (Figura 5B): el ORF1 (nt 61-5,880) codifica una poliproteína (220 kDa) involucrada en la replicación viral; ORF2 (TGB1) (nt 5,910-6,599), ORF3 (TGB2) (nt 6,577-6,897) y ORF4 (TGB3) (nt 6,879-7,067) codifican tres proteínas de 26 kDa, 11 kDa y 7 kDa, respectivamente, que son las proteínas del triple bloque de genes (TGB) asociadas al movimiento de célula a célula ‘tipo potex’ (Morozov y Solovyev, 2003); ORF5

(A) Cobertura de lecturas a lo largo del genoma del aislamiento CCV-1-Edo-Mex y porcentaje del contenido de guanina citosina, (B) Organización del genoma de CCV1-EdoMex, que muestra seis marcos de lectura abiertos y sus productos correspondientes. RNAdependiente RNA-polimerasa, (RdRp); cubierta proteica, (CP); proteína de unión al ácido nucleico, (NB); bloque de tres genes, (TGB).

(nt 6,866-8,011) codifica una proteína con un dominio de cubierta proteica (CP) típica de carlavirus y un dominio Flexi_CP; ORF6 (nt 8,004-8,324) codifica una proteína de unión a ácidos nucleicos (NB) de 12 kDa; y por último las regiones UTR 5’ (nt 1-60) y 3’ (8,325-8,395). El análisis filogenético agrupó al CCV-1-EdoMex, junto a los dos únicos genomas que se tienen disponibles en el GenBank de este virus (Figura 6) con un porcentaje de similitud a nivel de nucleótidos del 87.86 y 90.41 %.

Opuntia potexvirus A (OPV-A). En la muestra compuesta de la Ciudad de México se detectó un contig de 6,671 nt, que en la búsqueda BLASTx tuvo 77.5 % de identidad con Schlumbergera virus X (SchVX). La inspección adicional de la transcripción del genoma viral y la curación mediante el mapeo interactivo de las lecturas filtradas dio como resultado una secuencia viral consolidada de 6,644 nt respaldada por 10,536,601 lecturas con una cobertura promedio por nucleótido de 238,206.9X (Figura 7A). El genoma se encuentra organizado en cinco ORFs (Figura 7B). Al igual que otros potexvirus, el ORF1 (nt 85-4737) codifica la replicasa viral

Árbol filogenético de Máxima Verosimilitud de genomas completos de secuencias de nucleótidos de CCV-1 de este estudio (en negrita), así como otros aislamientos, y diferentes especies del género <italic>Carlavirus</italic>. Como grupo externo se utilizó al <italic>Apricot vein clearing associated virus</italic>, género <italic>Prunevirus.</italic> Los círculos en las ramas muestran valores de soporte UFBoot > 50%.

que consta de 1,550 aminoácidos (aa). Asimismo, posee un conjunto de tres ORFs parcialmente superpuestos: ORF2 (4,737-5,426 nt), ORF3 (5,389-5,721 nt) y ORF4 (5,651-5,842 nt), que muestran la configuración típica del bloque de tres genes (TGB) de los potexvirus. El ORF5 (5,854-6,531 nt) codifica la proteína de la cápside (CP). Finalmente, se detectaron las regiones UTR de 84 y 113 nt en los extremos 5’ y 3’, respectivamente.

Los motivos conservados de aa QDGAML, HQQAKDE y TFDANTE se identificaron en la región C-terminal de la replicasa viral (Van der Vlugt y Berendsen 2002). Por otra parte, un dominio replicasa catalítico, que contiene el motivo central de consenso característico TGX3TX3NTX22GDD encontrado en potexvirus (Martelli et al., 2007), estaba presente cerca del extremo C de la replicasa. También, se encontró el motivo hexanucleótido 5’-GGAAAA-3’, en el extremo 5’-

(A) Cobertura de lecturas a lo largo del genoma de <italic>Opuntia potexvirus A</italic> (OPV-A) y porcentaje de guanina/citosina, (B) Organización del genoma de OPV-A, que muestra cinco marcos de lectura abiertos y sus productos correspondientes: RdRp, replicasa viral; TGB, bloque de tres genes. CP, cubierta proteica.

UTR, el cual se tiene presente en algunos potexvirus (Chen et al., 2005), al igual que una putativa señal de poliadenilación en el extremo 3’-UTR.

La comparación por pares reveló identidades a nivel de aminoácidos que oscilaron del 59.8 al 82.2 % para la CP, y del 53.6 al 77.7 % para la replicasa viral (Figura 8a, b). El criterio de demarcación de especies para potexvirus, establece que especies distintas tienen <72 % nt o <80 % aa de identidad para los genes de la replicasa o cubierta proteica, respectivamente (Adams et al., 2004). Por lo anterior, el virus detectado en nopal se considera una nueva especie del género Potexvirus para el cual se propone el nombre de “Opuntia potexvirus A” (OPV-A). La secuencia del genoma de OPV-A se depositó en el GenBank con el número de acceso OQ240443. Los árboles filogenéticos basados en secuencias de aminoácidos de la replicasa viral y cubierta proteica de los virus pertenecientes a la familia Alfaflexiviridae muestran que OPV-A se agrupa con los potexvirus: Pitaya virus X (PiVX), Zygocactus virus X (ZyVX), Cactus virus X (CVX), SchVX y Opuntia virus X (OpVX), en un clado altamente respaldado (Figura 9 y 10).

Matriz de identidad del porcentaje de aminoácidos de la cápside proteica (A) y la replicasa viral, (B) de las especies del género <italic>Potexvirus</italic> más cercanas al Opuntia potexvirus A (en negrita).

Árbol filogenético de Máxima Verosimilitud de la familia <italic>Alphaflexiviridae</italic> basado en las secuencias de aminoácidos de la replicasa viral; la secuencia del Opuntia virus A se encuentra en negrita. Los colores del árbol representan los diferentes géneros de esta familia. Los círculos en las ramas muestran valores de soporte UFBoot >70%.

Árbol filogenético de Máxima Verosimilitud de la familia Alphaflexiviridae basado en las secuencias de aminoácidos de la cápside proteica; la secuencia de Opuntia virus A se encuentra en negrita. Los colores del árbol representan los diferentes géneros de esta familia. Los círculos en las ramas muestran valores de soporte UFBoot > 70 %.

Opuntia viroid I. En la muestra CDMX-1 se encontró un contig similar al de los viroides de la familia Pospiviroidae, al cual se denominó “Opuntia viroid I” (OVd-I). Los resultados del análisis BLASTn mostraron una similitud con Columnea latent viroid-B, con 14 % de cobertura de consulta y un E value = 4e-08. Para determinar el género al que pertenece el OVd-I, se realizó la inspección manual y curado de la secuencia. Se obtuvo un contig final de 412 pb con el cual se realizó un mapeo en los datos de HTS corroborando su presencia, con una cobertura promedio por nucleótido de 1,492X. La confirmación de OVd-I se realizó por RT-PCR y secuenciación Sanger.

La predicción de la estructura secundaria del OVd-I, mostró una molécula en forma de bastón con una región central conservada (CCR) (Figura 11), criterio principal para clasificar a un viroide como nuevo miembro de la familia Pospiviroidae. La presencia de la CCR y de una región conservada terminal (TCR) se tomaron en

Estructura secundaria predicha utilizando el servidor web UNAFold (Herramienta UNAFold disponible online: www.mfold.org) para OVd-I. Se resaltan los sitios que forman la región conservada terminal (TCR) en las posiciones 16 a 26 y la región conservada central (CCR) en las posiciones 84 a 100 y 313 a 329.

cuenta para ubicar al OVd-I dentro del género Apscaviroid (Di Serio et al., 2014). En la TCR no se detectaron cambios; sin embargo, en la CCR superior se detectaron cinco cambios (T/G,T/C,T/G,A/G,G/C) y en la CCR inferior se detectaron seis cambios (G/T,T/C,G/C,C/A,G/C,A/C) debidos probablemente a la divergencia del OVd-I con el género Apscaviroid.

Los resultados del análisis filogenético de Máxima Verosimilitud (Figura 12) ubicaron al OVd-I en el clado del género Apscaviroid de la familia Pospiviroidae. El análisis SDT, basado en comparaciones por pares, muestra que ninguna de las secuencias de viroides analizadas presenta más del 80 % de similitud con el genoma de OVd-I (Figura 13). Finalmente, OVd-I se detectó en las cuatro muestras independientes de la Ciudad de México y en una muestra de Morelos.

Otros virus detectados. Adicionalmente, en la muestra CDMX-1 se detectaron contigs virales adicionales (Cuadro 3). Sin embargo, solo se confirmó un caulimovirus y un vityvirus por RT-PCR. Por lo tanto, es necesario continuar con trabajos adicionales que permitan recuperar los genomas completos de estas potenciales nuevas especies de virus.

Detección de CCV-1. Se detectó en las cuatro entidades en estudio en el 72 % de muestras analizadas (Cuadro 4); se trata del primer reporte de la presencia de CCV1 en plantaciones comerciales de nopal verdura en México.

Árbol filogenético de Máxima Verosimilitud de la familia <italic>Pospiviroidae y Avsunviroidae</italic> basado en secuencias de nucleótidos de genomas completos de las especies representativas de los diferentes géneros. La secuencia obtenida del OVd-I se encuentra en negrita. Los diferentes colores representan los géneros de viroides. Los círculos en las ramas muestran valores de soporte UFBoot > 50 %.

Microscopía electrónica. En las muestras analizadas se observaron viriones de diferentes tamaños y formas (Figura 14). Se observaron partículas en forma de varilla rígida de aproximadamente 300 nm de longitud y 18 nm de diámetro, típicas de tobamovirus. Asimismo, se encontraron viriones en forma de varilla flexible, con una longitud promedio de 700 nm y 15 nm de diámetro, las cuales podrían pertenecer al CCV-1. También se observaron partículas virales flexibles de aproximadamente 500 nm de longitud.

 Discusión

En los últimos años, la secuenciación de alto rendimiento (HTS) ha permitido el descubrimiento de nuevas especies virales (Maliogka et al., 2018; Villamor et at., 2019), y con ello también se ha evidenciado la complejidad de los viromas (Al Rwahnih et al., 2011; Vučurović et al., 2021).

En México se han realizado investigaciones para conocer los virus asociados al nopal con síntomas putativos a virosis. Sin embargo, con el uso de técnicas

Distribución de frecuencia de identidades por pares obtenida con la herramienta de demarcación de secuencias SDT (<xref ref-type="bibr" rid="B28">Muhire <italic>et al</italic>., 2014</xref>) a partir de secuencias de genomas completos de especies de la familia <italic>Pospiviroidae</italic> para respaldar la demarcación del <italic>Opuntia viroid I</italic>, como una nueva especie.

especies para este género (Jan et al., 2020). Los potexvirus tienen partículas elongadas de aproximadamente 700 nm de longitud, infectan hospedantes herbáceos, no tienen vectores conocidos y se trasmiten principalmente de manera mecánica (Jan et al., 2020). Filogenéticamente el OPV-A se encuentra estrechamente relacionado con PiVX y SchVX que infectan naturalmente cactáceas (Figura 9 y 10).

Recientemente, en cactáceas ornamentales se reportaron los potexvirus CVX, OpVX, PiVX, SchVX y ZyVX, en infección única o mixta, de hasta cuatro de ellos (CVX, PiVX, SchVX y ZyVX) en una planta (Park et al., 2021). Adicionalmente

Resultado del análisis Blastx de virus potencialmente presentes en la biblioteca CDMX-1 y confirmación por RT-PCR y secuenciación.
Virus Longitud del contig Número de acceso de la secuencia de referencia Porcentaje de identidad (cobertura de consulta) Parte del genoma Confirmación por RT-PCR Confirmación por secuenciación Sanger
Caulimovirus 3168 QYR69113.1 47.14 (51) Putativa replicasa viral + +
Vityvirus 1242 AVL25840.1 52.21 (64) Proteína de movimiento + +
Alphavirus 2932 QYD13417.1 75 (27) Cápside proteica - -
Bammivirus 2110 UUL90866.1 39.75 (99) Replicasa viral - -
Betaflexiviridae (Tymovirales) 1096 AZM69108.1 36.36 (52) Proteína 1 del bloque de tres genes - -

+=Positivo; -=Negativo

Detección de CCV-1 en cuatro estados productores de nopal verdura en México.
Estado Muestras analizadas Muestras positivas a CCV-1 (%)
Estado de México 24 22 (91)
Morelos 26 16 (64)
Hidalgo 24 10 (41)
CDMX 55 45 (81)
Total 129 93 (72)

convencionales como RT-PCR, ELISA, microscopía electrónica de transmisión e indexado biológico, en varias investigaciones no fue posible determinar al (los) virus asociado(s), debido a las características y limitaciones que presentan estas técnicas (De La Torre-Almaraz et al., 2007; De La Torre-Almaraz et al., 2016a; De La Torre-Almaráz et al., 2016b; Alonso-Barrera et al., 2015). Con el uso de HTS es posible determinar la presencia de todos los virus (conocidos o desconocidos) en una muestra, característica que otras técnicas no poseen. Así, por ejemplo, con esta técnica se logró la detección de un nuevo tobamovirus (OV2) en una muestra compuesta de ARN extraído de O. ficus-indica y O. albicarpa recolectadas en el Estado de México (Salgado-Ortíz et al., 2020).

En este estudio se conoce por primera vez el viroma del nopal verdura cultivado en la zona centro de México, constituido por tres virus (dos nuevos, del género Potexvirus y Carlavirus) y un viroide (género Apscaviroid).

Opuntia potexvirus A (OPV-A) se propone como un nuevo miembro de la familia Alphaflexiviridae, género Potexvirus, con base en los criterios de demarcación de

Partículas virales en forma de varilla rígida (®) y flexible (®) de diferentes longitudes observadas por microscopía electrónica de transmisión en plantas de nopal con patrones amarillos irregulares, anillos amarillos, mosaico y manchas cloróticas alrededor de las espinas, utilizando la técnica “leaf dip”.

se informó que la cactácea Notocactus leninghausii f. cristatus, puede estar coinfectada hasta con seis virus, cuatro potexvirus (CVX, PiVX, SchVX y ZyVX) y dos tobamovirus (CMMoV y RCNaV) (Park et al., 2018). Estos reportes muestran que las cactáceas son hospedantes naturales de los potexvirus y tobamovirus. Sin embargo, los síntomas que causan de manera individual aún no se han descrito claramente ni se conoce su gama de hospedantes. Por lo anterior, en estudios posteriores tendrá que abordarse la caracterización biológica del potexvirus detectado en este estudio, para determinar, entre otras cosas, si representa un riesgo para la producción de nopal en México.

En el análisis de HTS, el CCV-1 se detectó en las muestras de la Ciudad de México y del Estado de México. Sin embargo, el genoma completo solo se recuperó en los cladodios recolectados en este último. La detección del genoma parcial en la muestra de la Ciudad de México, probablemente se deba a que el OPV-A y el OV2 suprimieron la replicación del CCV-1, por lo tanto, el número de secuencias obtenidas para este virus no cubrió la totalidad del genoma. El CCV-1 aislado del Estado de México, se agrupó en el mismo clado del aislamiento MK415316.1 reportado en Estados Unidos y una secuencia de México (KU854930.4) pero en una rama distinta. Este virus se detectó en las cuatro entidades muestreadas (Cuadro 4) tanto en plantas con síntomas de virosis como en plantas asintomáticas, en este último caso solamente en los estados de Hidalgo, Morelos y Ciudad de México. Se sabe que los carlavirus se transmiten por pulgones de forma no persistente, o por moscas blancas, infectan predominantemente plantas herbáceas y muchos de ellos causan infecciones latentes o asintomáticas, lo cual explicaría su detección en plantas de nopal que no presentaban alteraciones visibles (Kreuze et al., 2012). Los virus CCV-1 y cactus carlavirus 2 (CC-2), se detectaron por primera vez en una planta asintomática del híbrido ‘Professor Ebert’ de Epiphyllum spp. (Peng et al., 2019). Por lo tanto, en posteriores estudios, será necesario investigar el comportamiento biológico de ambos virus para determinar si bajo ciertas condiciones ambientales inducen algún síntoma en nopal y otras plantas de importancia económica. Asimismo, tendría que determinarse si constituyen un riesgo para la producción de nopal o algún otro cultivo.

El OV2 se reportó por primera vez en México en diferentes especies de cactáceas cultivadas. (O. ficus-indica y O. albicarpa) y no cultivadas (O. pilifera, O. depressa, O. tomentosa, O. robusta y O. streptacantha) del Estado de México, Puebla y Ciudad de México (Salgado-Ortíz et al., 2020). El género Tobamovirus se divide en siete grupos, de acuerdo con su hospedante natural, que incluye a las familias Solanaceae, Brassicaceae, Cucurbitaceae, Malvaceae, Cactaceae, Passifloraceae, Apocynaceae y Leguminosae (Li et al., 2017; Song et al., 2006). El análisis filogenético fue consistente con esta división, agrupando al OV2 en el clado de tobamovirus que infectan cactáceas (Figura 4). Otro tobamovirus reportado en México que infecta nopal es el Rattail cactus necrosis-associated virus (RCNaV). Este virus se reportó en la zona de Axapusco, Otumba, y San Martín de las Pirámides, Estado de México en plantas de nopal que mostraban anillos amarillos pequeños, (De La Torre-Almaráz et al., 2016a). Sin embargo, en este estudio no se detectó al RCNaV en ninguna de las muestras analizadas por HTS.

En la presente investigación se informa por primera vez a nivel mundial, la presencia de un viroide en nopal (OVd-I). Sin embargo, debido a que éste se encontró en muestras con infecciones mixtas con OV2, CCV-1 y OPV-A, se desconoce si provoca o no síntomas de manera individual.

Hasta ahora en México no existe una normatividad que regule el movimiento de material propagativo de nopal, por lo que existe el riesgo de la introducción de los virus y viroide encontrados en esta investigación a nuevas zonas productoras de esta especie.

 Conclusiones

El viroma del nopal verdura en cuatro zonas productoras del centro de México estuvo conformado por Opuntia virus 2 (género Tobamovirus), Cactus carlavirus 1 (Género Carlavirus), un nuevo virus cuyo nombre propuesto es Opuntia potexvirus A (Género Potexvirus) y un nuevo viroide que se propone nombrar Opuntia viroid I (Género Apscaviroid). Cactus carlavirus 1 se encontró en los cuatro estados productores de nopal muestreados

 Agradecimientos

Al Consejo Nacional de Humanidades Ciencia y Tecnología por la beca otorgada al primer autor para realizar sus estudios de doctorado. A los productores de nopal de los diferentes estados que dieron acceso a sus parcelas para la toma de muestras.

 Literatura Citada Adams, M.J., Antoniw, J.F., Bar-Joseph, M., Brunt, A.A., Candresse, T., Foster, G., Martelli, G.P., Milne, R.G. y Fauquet, C.M. (2004). Virology Division News: The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation. Archives of Virology, 149, 1045-1060. https://doi.org/10.1007/s00705-004-0304-0 Adams M.J. Antoniw J.F. Bar-Joseph M. Brunt A.A. Candresse T. Foster G. Martelli G.P. Milne R.G. Fauquet C.M. 2004 Virology Division News: The new plant virus family Flexiviridae and assessment of molecular criteria for species demarcation Archives of Virology 149 1045 1060 https://doi.org/10.1007/s00705-004-0304-0 Al Rwahnih, M., Daubert, S., Úrbez-Torres, J.R., Cordero, F. y Rowhani, A. (2011). Deep sequencing evidence from single grapevine plants reveals a virome dominated by mycoviruses. Archives of Virology, 156, 397-403. https://doi.org/10.1007/s00705-010-0869-8 Al Rwahnih M. Daubert S. Úrbez-Torres J.R. Cordero F. Rowhani A. 2011 Deep sequencing evidence from single grapevine plants reveals a virome dominated by mycoviruses Archives of Virology 156 397 403 https://doi.org/10.1007/s00705-010-0869-8 Alonso-Barrera, B., Mora-Aguilera, G., Valdovinos-Ponce, G., Ochoa-Martínez, D.L., Rodríguez-Leyva, E., Tlapal-Bolaños, B. y De La Torre-Almaraz, R. (2015). Asociación de un Potexvirus como agente causal de manchas cloróticas en Opuntia ficus-indica. Mexican Journal of Phytopathology, 33(\1\), 75-86. http://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S018533092015000100075&lng=es&tlng=es Alonso-Barrera B. Mora-Aguilera G. Valdovinos-Ponce G. Ochoa-Martínez D.L. Rodríguez-Leyva E. Tlapal-Bolaños B. De La Torre-Almaraz R. 2015 Asociación de un Potexvirus como agente causal de manchas cloróticas en Opuntia ficus-indica Mexican Journal of Phytopathology 33 1\ 75 86 http://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S018533092015000100075&lng=es&tlng=es Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online] . Available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc Andrews S. 2010 FastQC: A Quality Control Tool for High Throughput Sequence Data [Online] Available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc Barbera, G.F., Carimi, P., Inglese, M. y Panno, M. (1992). Physical, morphological and chemical changes during fruit development and ripening in three cultivars of prickly-pear (Opuntia ficus-indica (L.) Miller). Journal of Horticultural Science, 67, 307-312. https://doi.org/10.1080/00221589.1992.11516253 Barbera G.F. Carimi P. Inglese M. Panno M. 1992 Physical, morphological and chemical changes during fruit development and ripening in three cultivars of prickly-pear (Opuntia ficus-indica (L.) Miller) Journal of Horticultural Science 67 307 312 https://doi.org/10.1080/00221589.1992.11516253 Bravo, H. (1978). Las Cactáceas de México. 2nd ed., Vol. I. México: Universidad Nacional Autónoma de México. 743. Bravo H. 1978 Las Cactáceas de México Vol. I. México Universidad Nacional Autónoma de México 743 743 Chen, J., Shi, Y.H., Adams, M.J. y Chen, J.P. (2005). The complete sequence of the genomic RNA of an isolate of Lily virus X (genus Potexvirus). Archives of Virology, 150, 825-832. https://doi.org/10.1007/s00705-004-0441-5 Chen J. Shi Y.H. Adams M.J. Chen J.P. 2005 The complete sequence of the genomic RNA of an isolate of Lily virus X (genus Potexvirus) Archives of Virology 150 825 832 https://doi.org/10.1007/s00705-004-0441-5 Chen, S., Zhou, Y., Chen, Y. y Gu, J. (2018). fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics, 34(\17\), i884-i890. https://doi.org/10.1093/bioinformatics/bty560 Chen S. Zhou Y. Chen Y. Gu J. 2018 fastp: an ultra-fast all-in-one FASTQ preprocessor Bioinformatics 34 17\ i884 i890 https://doi.org/10.1093/bioinformatics/bty560 De La Torre-Almaraz, R., Salazar-Segura, M. y Ruiz-Medrano, R. (2007). Ocurrencia de un tobamovirus asociado con manchas anulares amarillas en nopal tunero en México. Agrociencia, 41, 763-773. https://www.scielo.org.mx/pdf/agro/v41n7/1405-3195-agro-41-07-763.pdf De La Torre-Almaraz R. Salazar-Segura M. Ruiz-Medrano R. 2007 Ocurrencia de un tobamovirus asociado con manchas anulares amarillas en nopal tunero en México Agrociencia 41 763 773 https://www.scielo.org.mx/pdf/agro/v41n7/1405-3195-agro-41-07-763.pdf De La Torre-Almaraz, R., Salgado-Ortíz, H., Salazar-Segura, M., Pallás, V., Sánchez-Navarro, J.A. y Valverde, R.A. (2016). First report of Schlumbergera virus X in prickly pear (Opuntia ficus-indica). Plant Disease, 100, 1799. https://doi.org/10.1094/pdis-11-15-1326-pdn De La Torre-Almaraz R. Salgado-Ortíz H. Salazar-Segura M. Pallás V. Sánchez-Navarro J.A. Valverde R.A. 2016 First report of Schlumbergera virus X in prickly pear (Opuntia ficus-indica) Plant Disease 100 1799 1799 https://doi.org/10.1094/pdis-11-15-1326-pdn De La Torre-Almaraz, R., Salgado-Ortíz, H., Salazar-Segura, M., Pallás, V., Sánchez-Navarro, J.A. y Valverde, R.A. (2016). First Report of Rattail cactus necrosis-associated virus in Prickly Pear Fruit (Opuntia albicarpa Scheinvar) in Mexico. Plant Disease, 100, 11. https://doi.org/10.1094/pdis-04-16-0554-pdn De La Torre-Almaraz R. Salgado-Ortíz H. Salazar-Segura M. Pallás V. Sánchez-Navarro J.A. Valverde R.A. 2016 First Report of Rattail cactus necrosis-associated virus in Prickly Pear Fruit (Opuntia albicarpa Scheinvar) in Mexico Plant Disease 100 11 11 https://doi.org/10.1094/pdis-04-16-0554-pdn Di Serio, F., Flores, R., Verhoeven, J.T.J., Li, S.F., Pallás, V., Randles, J.W., Sano, T., Vidalakis, G. y Owens, R.A. (2014). Current status of viroid taxonomy. Archives of Virology, 159, 3467-3478. https://doi.org/10.1007/s00705-014-2200-6 Di Serio F. Flores R. Verhoeven J.T.J. Li S.F. Pallás V. Randles J.W. Sano T. Vidalakis G. Owens R.A. 2014 Current status of viroid taxonomy Archives of Virology 159 3467 3478 https://doi.org/10.1007/s00705-014-2200-6 Fontenele, R.S., Salywon, A.M., Majure, L.C., Cobb, N., Bhaskara, A., Avalos-Calleros, J.A., Argüello-Astorga, G.R., Schmidlin, K. y Khalifeh, A. (2020). A Novel Divergent Geminivirus Identified in Asymptomatic New World Cactaceae Plants. Viruses, 12, 398. https://doi.org/10.3390/v12040398 Fontenele R.S. Salywon A.M. Majure L.C. Cobb N. Bhaskara A. Avalos-Calleros J.A. Argüello-Astorga G.R. Schmidlin K. Khalifeh A. 2020 A Novel Divergent Geminivirus Identified in Asymptomatic New World Cactaceae Plants Viruses 12 398 398 https://doi.org/10.3390/v12040398 Fontenele, R.S., Salywon, A.M., Majure, L.C., Cobb, N., Bhaskara, A., Avalos-Calleros, J.A., Argüello-Astorga, G.R., Schmidlin, K. y Khalifeh, A. (2021). New World Cactaceae Plants Harbor Diverse Geminiviruses. Viruses, 13(\4\), 694. https://doi.org/10.3390/v13040694 Fontenele R.S. Salywon A.M. Majure L.C. Cobb N. Bhaskara A. Avalos-Calleros J.A. Argüello-Astorga G.R. Schmidlin K. Khalifeh A. 2021 New World Cactaceae Plants Harbor Diverse Geminiviruses Viruses 13 4\ 694 694 https://doi.org/10.3390/v13040694 Griffith, M.P. (2004). The origins of an important cactus crop, Opuntia ficus-indica (Cactaceae): new molecular evidence. American Journal of Botany, 91, 1915-1921. https://doi.org/10.3732/ajb.91.11.1915 Griffith M.P. 2004 The origins of an important cactus crop, Opuntia ficus-indica (Cactaceae): new molecular evidence American Journal of Botany 91 1915 1921 https://doi.org/10.3732/ajb.91.11.1915 Jan, F.K., Vaira, A.M., Menzel, W., Candresse, T., Zavriev, S.K., Hammond, J., Ryu, K.H. y ICTV Report Consortium (2020). ICTV Virus Taxonomy Profile: Alphaflexiviridae. Journal of General Virology, 101, 699-700. https://doi.org/10.1099/jgv.0.001436 Jan F.K. Vaira A.M. Menzel W. Candresse T. Zavriev S.K. Hammond J. Ryu K.H. ICTV Report Consortium 2020 ICTV Virus Taxonomy Profile: Alphaflexiviridae Journal of General Virology 101 699 700 https://doi.org/10.1099/jgv.0.001436 Kalyaanamoorthy, S., Minh, B.Q., Wong, T.K.F., Haeseler, A.V. y Jermiin, L.S. (2017). ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods, 14, 587-589. https://doi.org/10.1038/nmeth.4285 Kalyaanamoorthy S. Minh B.Q. Wong T.K.F. Haeseler A.V. Jermiin L.S. 2017 ModelFinder: Fast model selection for accurate phylogenetic estimates Nature Methods 14 587 589 https://doi.org/10.1038/nmeth.4285 Katoh, K., Rozewicki, J. y Yamada, K.D. (2019). MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief in Bioinformatics, 20, 1160-1166. https://doi.org/10.1093/bib/bbx108 Katoh K. Rozewicki J. Yamada K.D. 2019 MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization Brief in Bioinformatics 20 1160 1166 https://doi.org/10.1093/bib/bbx108 Kreuze, J.F., Vaira, A.M., Menzel, W., Candresse, T., Zavriev, S.K., Hammond, J., Ryu, K.H. y ICTV Report Consortium (2020). ICTV Virus Taxonomy Profile: Alphaflexiviridae. Journal of General Virology, 101, 699-700. https://doi.org/10.1099/jgv.0.001436 Kreuze J.F. Vaira A.M. Menzel W. Candresse T. Zavriev S.K. Hammond J. Ryu K.H. ICTV Report Consortium 2020 ICTV Virus Taxonomy Profile: Alphaflexiviridae Journal of General Virology 101 699 700 https://doi.org/10.1099/jgv.0.001436 Lan, P., Tian, T., Pu, L., Rao, W., Li, F. y Li, R. (2019). Characterization and detection of a new badnavirus infecting Epiphyllum spp. Archives of Virology, 164, 1837-1841. https://doi.org/10.1007/s00705-019-04237-6 Lan P. Tian T. Pu L. Rao W. Li F. Li R. 2019 Characterization and detection of a new badnavirus infecting Epiphyllum spp Archives of Virology 164 1837 1841 https://doi.org/10.1007/s00705-019-04237-6 Langmead, B. y Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nature Methods, 9(\4\), 357-359. https://doi.org/10.1038/nmeth.1923 Langmead B. Salzberg S.L. 2012 Fast gapped-read alignment with Bowtie 2 Nature Methods 9 4\ 357 359 https://doi.org/10.1038/nmeth.1923 Letunic, I. y Bork, P. (2021). Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Research, 49, W293-W296. https://doi.org/10.1093/nar/gkab301 Letunic I. Bork P. 2021 Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation Nucleic Acids Research 49 W293 W296 https://doi.org/10.1093/nar/gkab301 Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G. y Durbin, R. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics (Oxford, England), 25(\16\), 2078-2079. https://doi.org/10.1093/bioinformatics/btp352 Li H. Handsaker B. Wysoker A. Fennell T. Ruan J. Homer N. Marth G. Abecasis G. Durbin R. 2009 The Sequence Alignment/Map format and SAMtools Bioinformatics (Oxford, England) 25 16\ 2078 2079 https://doi.org/10.1093/bioinformatics/btp352 Li, Y., Wang, Y., Hu, J., Xiao, L., Tan, G., Lan, P., Liu, Y. y Li, F. (2017). The complete genome sequence, occurrence and host range of tomato mottle mosaic virus Chinese isolate. Virology Journal, 14, 1-9. https://doi.org/10.1186/s12985-016-0676-2 Li Y. Wang Y. Hu J. Xiao L. Tan G. Lan P. Liu Y. Li F. 2017 The complete genome sequence, occurrence and host range of tomato mottle mosaic virus Chinese isolate Virology Journal 14 1 9 https://doi.org/10.1186/s12985-016-0676-2 Maliogka, V., Minafra, A., Saldarelli, P., Ruiz-García, A., Glasa, M., Katis, N. y Olmos, A. (2018). Recent Advances on Detection and Characterization of Fruit Tree Viruses Using High-Throughput Sequencing Technologies. Viruses, 10, 436. https://doi.org/10.3390/v10080436 Maliogka V. Minafra A. Saldarelli P. Ruiz-García A. Glasa M. Katis N. Olmos A. 2018 Recent Advances on Detection and Characterization of Fruit Tree Viruses Using High-Throughput Sequencing Technologies Viruses 10 436 436 https://doi.org/10.3390/v10080436 Martelli, G.P., Adams, M.J., Kreuze, J.F. y Dolja, V.V. (2007). Family Flexiviridae: A Case Study in Virion and Genome Plasticity. Annual Review of Phytopathology, 45, 73-100. https://doi.org/10.1146/annurev.phyto.45.062806.094401 Martelli G.P. Adams M.J. Kreuze J.F. Dolja V.V. 2007 Family Flexiviridae: A Case Study in Virion and Genome Plasticity Annual Review of Phytopathology 45 73 100 https://doi.org/10.1146/annurev.phyto.45.062806.094401 Minh, B.Q., Schmidt, H.A., Chernomor, O., Schrempf, D., Woodhams, M.D., Haeseler, A.V.R. y Lanfear, . (2020). IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution, 37, 1530-1534. https://doi.org/10.1093/molbev/msaa015 Minh B.Q. Schmidt H.A. Chernomor O. Schrempf D. Woodhams M.D. Haeseler A.V.R. Lanfear . 2020 IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era Molecular Biology and Evolution 37 1530 1534 https://doi.org/10.1093/molbev/msaa015 Muhire, B.M., Varsani, A. y Martin, D.P. (2014). SDT: A virus classification tool based on pairwise sequence alignment and identity calculation. PLoS One, 9(\9\), e108277. https://doi.org/10.1371/journal.pone.0108277 Muhire B.M. Varsani A. Martin D.P. 2014 SDT: A virus classification tool based on pairwise sequence alignment and identity calculation PLoS One 9 9\ e108277 https://doi.org/10.1371/journal.pone.0108277 Okonechnikov, K., Conesa, A. y García-Alcalde, F. (2016). Qualimap 2: advanced multisample quality control for high-throughput sequencing data. Bioinformatics (Oxford, England), 32(\2\), 292-294. https://doi.org/10.1093/bioinformatics/btv566 Okonechnikov K. Conesa A. García-Alcalde F. 2016 Qualimap 2: advanced multisample quality control for high-throughput sequencing data Bioinformatics (Oxford, England) 32 2\ 292 294 https://doi.org/10.1093/bioinformatics/btv566 Park, C.H., Song, E.G. y Ryu, K.H. (2018). Detection of co-infection of Notocactus leninghausii f. cristatus with six virus species in South Korea. The Plant Pathology Journal, 34, 65-70. https://doi.org/10.5423/PPJ.NT.08.2017.0187 Park C.H. Song E.G. Ryu K.H. 2018 Detection of co-infection of Notocactus leninghausii f. cristatus with six virus species in South Korea The Plant Pathology Journal 34 65 70 https://doi.org/10.5423/PPJ.NT.08.2017.0187 Park, C.H., Song, E.G. y Ryu, K.H. (2021). A multiplex PCR assay for the simultaneous detection of five potexviruses infecting cactus plants using dual-priming oligonucleotides (DPOs) primers. Journal of Virological Methods, 298, 114280. https://doi.org/10.1016/j.jviromet.2021.114280 Park C.H. Song E.G. Ryu K.H. 2021 A multiplex PCR assay for the simultaneous detection of five potexviruses infecting cactus plants using dual-priming oligonucleotides (DPOs) primers Journal of Virological Methods 298 114280 114280 https://doi.org/10.1016/j.jviromet.2021.114280 Peng, L., Wu, L., Grinstead, S.C., Kinard, G.R. y Li, R. (2019). Molecular characterization and detection of two novel carlaviruses infecting cactus. Archives of Virology, 164, 1873-1876. https://doi.org/10.1007/s00705-019-04279-w Peng L. Wu L. Grinstead S.C. Kinard G.R. Li R. 2019 Molecular characterization and detection of two novel carlaviruses infecting cactus Archives of Virology 164 1873 1876 https://doi.org/10.1007/s00705-019-04279-w Prjibelski, A., Antipov, D., Meleshko, D., Lapidus, A. y Korobeynikov, A. (2020). Using SPAdes de novo assembler. Curr Protoc Bioinformatics, 70( 1 ), e102. https://doi.org/10.1002/cpbi.102 Prjibelski A. Antipov D. Meleshko D. Lapidus A. Korobeynikov A. 2020 Using SPAdes de novo assembler Curr Protoc Bioinformatics 70 1 e102 https://doi.org/10.1002/cpbi.102 Salgado-Ortíz, H., De La Torre-Almaraz, R., Sánchez-Navarro, J.A. y Pallás, V. (2020). Identification and genomic characterization of a novel tobamovirus from prickly pear cactus. Archives of Virology, 165, 781-784. https://doi.org/10.1007/s00705-020-04528-3 Salgado-Ortíz H. De La Torre-Almaraz R. Sánchez-Navarro J.A. Pallás V. 2020 Identification and genomic characterization of a novel tobamovirus from prickly pear cactus Archives of Virology 165 781 784 https://doi.org/10.1007/s00705-020-04528-3 Sastry, K.S., Mandal, B., Hammond, J., Scott, S.W. y Briddon, R.W. (2019). Narcissus spp. (Daffodil). En: Sastry, K.S.y Mandal, B. (Encyclopedia of plant viruses and viroids). New Delhi: Springer. https://doi.org/10.1007/978-81-322-3912-3_608 Sastry K.S. Mandal B. Hammond J. Scott S.W. Briddon R.W. 2019 Narcissus spp. (Daffodil) Sastry K.S. Mandal B. Encyclopedia of plant viruses and viroids New Delhi Springer https://doi.org/10.1007/978-81-322-3912-3_608 SIAP (2022). Avance agrícola. SIAP. https://nube.siap.gob.mx/avance_agricola SIAP 2022 Avance agrícola SIAP https://nube.siap.gob.mx/avance_agricola Song, Y.S., Min, B.E., Hong, J.S., Rhie, M.J., Kim, M.J. y Ryu, K.H. (2006). Molecular evidence supporting the confirmation of Maracuja mosaic virus as a species of the genus Tobamovirus and production of an infectious cDNA transcript. Archives of Virology, 151, 2337-2348. https://doi.org/10.1007/s00705-006-0823-y Song Y.S. Min B.E. Hong J.S. Rhie M.J. Kim M.J. Ryu K.H. 2006 Molecular evidence supporting the confirmation of Maracuja mosaic virus as a species of the genus Tobamovirus and production of an infectious cDNA transcript Archives of Virology 151 2337 2348 https://doi.org/10.1007/s00705-006-0823-y Thorvaldsdóttir, H., Robinson, J.T. y Mesirov, J.P. (2013). Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in Bioinformatics, 14(\2\), 78-192. https://doi.org/10.1093/bib/bbs017 Thorvaldsdóttir H. Robinson J.T. Mesirov J.P. 2013 Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration Briefings in Bioinformatics 14 2\ 78 192 https://doi.org/10.1093/bib/bbs017 Van der Vlugt, R.A. y Berendsen, M. (2002). Development of a General Potexvirus Detection Method. European Journal of Plant Pathology, 108, 367-371. https://doi.org/10.1023/A:1015644409484 Van der Vlugt R.A. Berendsen M. 2002 Development of a General Potexvirus Detection Method European Journal of Plant Pathology 108 367 371 https://doi.org/10.1023/A:1015644409484 Villamor, D.E.V., Ho, T., Al Rwahnih, M., Martin, R.R. y Tzanetakis, I.E. (2019). High throughput sequencing for plant virus detection and discovery. Phytopathology, 109, 716-725. https://doi.org/10.1094/PHYTO-07-18-0257-RVW Villamor D.E.V. Ho T. Al Rwahnih M. Martin R.R. Tzanetakis I.E. 2019 High throughput sequencing for plant virus detection and discovery Phytopathology 109 716 725 https://doi.org/10.1094/PHYTO-07-18-0257-RVW Vučurović, A., Kutnjak, D., Mehle, N., Stanković, I., Pecman, A., Bulajić, A., Krstić, B. y Ravnikar, M. (2021). Detection of four new tomato viruses in Serbia using post hoc high-throughput sequencing analysis of samples from a large-scale field survey. Plant Disease, 105, 2325-2332. https://doi.org/10.1094/PDIS-09-20-1915-RE Vučurović A. Kutnjak D. Mehle N. Stanković I. Pecman A. Bulajić A. Krstić B. Ravnikar M. 2021 Detection of four new tomato viruses in Serbia using post hoc high-throughput sequencing analysis of samples from a large-scale field survey Plant Disease 105 2325 2332 https://doi.org/10.1094/PDIS-09-20-1915-RE Zheng, L., Cao, M., Wu, L., Liu, H., Chen, M. y Li, R. (2020). First identification and molecular characterization of a novel cavemovirus infecting Epiphyllum spp. Archives of Virology, 165, 2083-2086. https://doi.org/10.1007/s00705-020-04688-0 Zheng L. Cao M. Wu L. Liu H. Chen M. Li R. 2020 First identification and molecular characterization of a novel cavemovirus infecting Epiphyllum spp Archives of Virology 165 2083 2086 https://doi.org/10.1007/s00705-020-04688-0 Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research, 31, 3406-3415. https://doi.org/10.1093/nar/gkg595 Zuker M. 2003 Mfold web server for nucleic acid folding and hybridization prediction Nucleic Acids Research 31 3406 3415 https://doi.org/10.1093/nar/gkg595 Scientific Article Virome of the vegetable prickly pear cactus in the central zone of Mexico Abstract Objective / Background.

In this study, the ability of high-throughput sequencing (HTS) to detect viruses in vegetable prickly pear cactus was exploited.

 Materials and Methods.

Samples from State of Mexico (EDMX), Hidalgo, and Morelos, as well as Mexico City (CDMX), were analyzed.

 Results.

In the sample from EDMX, the genomes of Opuntia virus 2 (OV2, genus Tobamovirus) and Cactus carlavirus 1 (CCV-1, genus Carlavirus) were detected and recovered. In the sample from CDMX, in addition to OV2 and CCV-1, a new viroid and potexvirus were detected. The former has a circular RNA genome with a length of 412 nt for which the name “Opuntia viroid I” (OVd-I) is proposed. The primary structure of this viroid showed a nucleotide sequence identity of less than 80% with any of the currently known viroids and a phylogenetic relationship with the genus Apscaviroid (Family Pospiviroidae) with which it shares conserved structural motifs.

 Conclusion.

The new potexvirus was named Opuntia potexvirus A (OPV-A), whose viral replicase sequence has a 77.7 % amino acid identity with Schlumbergera virus X. Finally, CCV-1 was detected in 93 (72 %) of 129 vegetable prickly pear cactus samples collected in the four entities.

 Keywords: Cactaceae HTS Viroid Potexvirus Tobamovirus Carlavirus.

Opuntia ficus-indica stands as the most economically significant cactus globally, with cultivation spanning across the continents of America, Africa, Asia, Europe, and Oceania (Barbera et al., 1992). Originating in Mexico, this species underwent domestication (Griffith, 2004), a process that has yielded the greatest diversity of cultivars within the region (Bravo, 1978). The fruits and cladodes of Opuntia ficus- indica are utilized, contingent upon the specific cultivar. In Mexico, an estimated 12,618 hectares are allocated to the cultivation of “vegetable prickly pear cactus” for human consumption (SIAP, 2022). Notably, the primary producing regions for vegetable prickly pear cactus are Morelos and Mexico City, jointly constituting 50% of the total cultivated area. Diverse products and by-products are derived from the cladodes, serving as raw materials for the production of various anti-diabetic preparations. Additionally, the flowers are employed in the preparation of diuretic beverages, while the fruits find application in the creation of juices, jellies, honey, preserves, and pastes, among other products. The seeds of Opuntia ficus-indica are a source of oil. Furthermore, this cactus is cultivated as a host for the “cochineal scale” (Dactylopius coccus), an insect utilized in the production of carminic acid dye (Barbera et al., 1992).

Globally, various viruses have been identified in cacti, the majority of which possess a single-stranded RNA genome (Sastry et al., 2019). Furthermore, two caulimoviruses that infect Epiphyllum spp. have been documented (Lan et al., 2019; Zheng et al., 2020), along with three geminiviruses found in several cactus species (Fontenele et al., 2020; 2021).

In Mexico, specifically in the municipalities of Axapusco, Otumba, and San Martín de las Pirámides (State of Mexico), Rattail cactus necrosis-associated virus (RCNaV), a tobamovirus, was reported in prickly pear cactus plants exhibiting small spots and yellow rings on the cladodes (De La Torre-Almaraz et al., 2016a). In the same region, the presence of a potexvirus, Schlumbergera virus X (SchVX), was also identified in prickly pear cactus plants showing irregular spots and deformation of cladodes (De La Torre-Almaraz et al., 2016a). Additionally, in cladodes of prickly pear cactus displaying symptoms of chlorotic halos and irregular spots, both a tobamovirus and a potexvirus were detected in the localities of San Martín de las Pirámides (State of Mexico) and Cuautepec de Hinojosa (Hidalgo), respectively. However, the species could not be conclusively determined (De La Torre-Almaraz et al.,2007; Alonso-Barrera et al., 2015). Lastly, a tobamovirus named Opuntia virus 2 (OV2) was identified through high-throughput sequencing (HTS) in species of the Opuntia genus in Mexico (Salgado-Ortíz et al., 2020).

Other significant plant pathogens include viroids, small circular single-stranded RNA molecules of approximately 400 nucleotides (nt) in length that can replicate autonomously. In contrast to viruses, there is no evidence that viroids encode any proteins, and their genomes are not protected by a capsid (Di Serio et al., 2014). Taxonomically, viroids are classified into two families: a) Pospiviroidae, comprising five genera (Apscaviroid, Cocadviroid, Coleviroid, Hostuviroid, and Pospiviroid), and b) Avsunviroidae, consisting of three genera (Avsunviroid, Pelamoviroid, and Elaviroid) (Di Serio et al., 2018; 2021). Some viroids can severely impact the production of various crops, while others replicate without inducing symptoms in susceptible plants (Di Serio et al., 2014).

Advances in sequencing technologies have made High-Throughput Sequencing (HTS) more accessible to a broader range of users (Vučurović et al., 2021). The application of HTS has revolutionized plant virology, expediting the discovery of new virus species in ecosystems and enhancing our understanding of the diversity of these phytopathogens (Fontenele et al., 2020; Vučurović et al., 2021). Consequently, the objective of this study was to explore the virome of vegetable prickly pear cactus and determine the distribution of Cactus carlavirus 1 (CCV-1) in four vegetable prickly pear cactus-producing states in Mexico.

Materials and Methods

High Throughput Sequencing (HTS). Two samples displaying putative virus symptoms, referred to as CDMX-1 and EM-1, underwent HTS. CDMX-1 comprised cladodes (n=4) exhibiting irregular yellow patterns, yellow rings, and mosaic, from the Milpa Alta borough in Mexico City (Figure 1A-D). The EM-1 sample (n=1) was a plant from Oxtotipac, in the Otumba Municipality, showing chlorotic spots around the thorns, locally termed “pinto” by producers (Figure 1E). In both cases, RNA was extracted using the SV Total RNA Isolation System kit (Promega, USA), following the manufacturer’s instructions. The EM-1 sample was sent to Macrogen Inc. (Korea), where the library was prepared using TruSeq stranded total RNA, pre-treated with Ribo-Zero Plant. Sequencing was performed on an Illumina NovaSeq6000 instrument with 150-bp PE. The CDMX-1 sample was sent to BGI Genomics (China), where the Eukaryotic Strand-specific mRNA library was constructed, and sequencing took place on the DNBSEQ platform with 150-bp PE.

Bioinformatics analysis. Adapters and low-quality sequences from the data obtained from Macrogen were removed using Fastp (Chen et al., 2018). On the other hand, sequences from BGI were received clean and without adapters, and they were verified using FastQC (Andrews, 2010). Clean reads were de novo assembled using the SPAdes software (Prjibelski et al., 2020). The obtained contigs underwent BLASTx and BLASTn searches against a local database of viruses/ viroids. Subsequently, the narrowed list of viral hits was compared to the complete non-redundant (nr) GenBank database using BLASTx and BLASTn (Vučurović et al., 2021).

Symptoms associated with virosis in vegetable prickly pear cactus cladodes. (A-D) Samples of prickly pear cactus collected in Mexico City, Milpa Alta Borough, (E) Prickly pear cactus sample collected in the State of Mexico, Otumba Municipality, (F) Healthy prickly pear cactus sample from the State of Mexico.

For genome reconstruction, Bowtie2 (Langmead and Salzberg, 2012), Samtools (Li et al., 2009), and Integrative Genomic Viewer (IGV) version 2.3 (Thorvaldsdóttir et al., 2013) were employed. The assembly characteristics of the obtained genomes were determined using Qualimap (Okonechnikov et al., 2016), where the average coverage per nucleotide for each genome was calculated. Finally, the obtained genomes were annotated using ORFinder from the National Center for Biotechnology Information (NCBI) and deposited in GenBank.

Phylogenetic analysis. The obtained genomes were aligned with representative species of the Tobamovirus genus from the NCBI database. The GTR+F+R5 nucleotide substitution model was used. Additionally, a phylogenetic tree was constructed by aligning complete genome sequences of representative members of the Carlavirus genus (family: Betaflexiviridae), obtained from the NCBI, along with a virus isolate obtained in this study. The estimated evolutionary model was GTR+F+R5. For new viruses, two phylogenetic trees were constructed by aligning amino acid sequences of viral replicase and capsid protein from different species in the corresponding family obtained from the International Committee on Taxonomy of Viruses (ICTV) (Kreuze et al., 2020), including the sequence obtained in this study. The evolutionary model for the viral replicase was LG+F+R7, and for the capsid protein, it was LG+F+R5. Regarding the phylogenetic analysis of the new viroid, sequences of representative species from both families of these pathogens obtained from the NCBI were used, and the evolutionary model applied was HKY+F+G4.

In all cases, trees were generated using the Maximum Likelihood method with IQTREE 2 (Minh et al., 2020), multiple sequence alignment with MAFFT (Katoh et al., 2019), and the evolutionary model determined by the Bayesian Information Criterion implemented in ModelFinder (Kalyaanamoorthy et al., 2017). Nodal support was assessed with ultrafast bootstrap (UFBoot) by running a total of 1000 replicates. Finally, tree visualization and editing were carried out using iTOL (Letunic and Bork, 2021).

Pairwise identity analysis. To strengthen the classification of the new species, pairwise identity was estimated using SDT v1.2 (Muhire et al., 2014), comparing the replicase and capsid protein of the closest viruses, as well as different genomes from the Pospiviroidae family in the case of the viroid.

Secondary structure prediction of the new viroid. It was obtained using the UNAFold web server (www.mfold.org, accessed on November 18, 2022) (Zuker, 2003).

Validation of the detection of the new viruses and viroid. A portion of the RNA extracted from symptomatic cladodes that was submitted for HTS underwent RT- PCR to confirm the presence of the viroid and viruses identified. Various primers were designed (Table 1) based on the obtained sequences. Additionally, RT-PCR analyses were conducted to detect one of the viruses in four independent samples collected in different locations: Mexico City (n=1, asymptomatic), State of Mexico (n=2), Hidalgo (n=2), and Morelos (n=2).

In all cases, cDNA synthesis was carried out using M-MLV Reverse Transcriptase (200 U μL-1) (Promega, USA) from 1 μL of total RNA and 1 μL (10 mM) of the reverse primer, following the manufacturer’s instructions. The obtained cDNA served as a template for PCR, and the reaction mixture consisted of 2 μL of reaction buffer (5X Green GoTaq®), 0.6 μL of MgCl2 (25 mM), 0.2 μL of dNTPs Mix (10 mM), 0.6 μL (10 μM) of each primer (forward and reverse), 4.9 μL of ultrapure water, 0.1 μL of GoTaq® DNA Polymerase (5 U μL-1) (Promega, USA), and 1 μL of

used in RT-PCR assays for the validation of viruses/viroids detected in the HTS data from two vegetable prickly pear cactus libraries.
Primers name Virus/Viroide (Region) Sequence (5'->3') Amplicon (pb) Alignment temperature (°C)
OV2-F Opuntia virus 2 (Movement protein) CGG GTC CTT TTC CTT TTG TCT GTC 667 55
OV2-R GAGAGCGAGTAGAAACTCCAACG
CCV1-F Cactus carlavirus 1 (Viral replicase) GAAGCGCATGGGCTGTATTG 459 55
CCV1-R GTCTGCGCAGCTTTAGCATC
Opuntia_Potex-F(RdRp) Opuntia potexvirus A (Viral replicase) ACCCACTAGCCATTGAAGCC 580 55
Opuntia_Potex-R(RdRp) AGGTGGTTGGCACCTTTTGA
Caulimovirus_F Caulimovirus (Retro transcriptase TCCTCACACTAGTCCTGCCT 846 55
Caulimovirus_R TTGAGGACGGCACTCCAATG
Alphavirus-F(RdRp) Alphavirus (Coat protein) CACTGGCGTGTTTTAGCCAC 579 55
Alphavirus-R(RdRp) TCAGCCTCCAGCCACAAAAT
Tymovirus-F Timovirus (Triple gene block protein) CTGGAGCGCCTTGGAACTAA 745 55
Tymovirus-R TTTGCCAACCCTCACCATGA
Vityvirus-F Vityvirus (Movement protein) GAACTGCTTGATATGCGCCG 229 55
Vityvirus-R CCTGACGGACCACACTCATC
Banmivirus_Opun-F Banmivirus (Viral replicase) CAGAGCGCCAATTAACCTGC 707 55
Banmivirus_Opun-R CGCTCTTGAAGGTTAGCCCA
OPV-I-1F Opuntia viroid I (Part of the genome) TTGACCTAGGTTGGCTCTCG 362 55
OPV-I-1R GCAGGAGAAGGCCAGGAAG
OPV-I-2F Opuntia viroid I (Part of the genome) GGGATCAACCTTGTGGTTCCT 351 55
OPV-I-2R GAAAGAAAAGCACCTGTGGGC

cDNA in a final volume of 10 μL. PCR conditions included an initial incubation at 95 °C for 3 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 40 s, and a final extension cycle at 72 °C for 10 min. PCR products were sequenced using the Sanger method at Macrogen Inc.

CCV-1 Detection. A total of 129 samples collected from cladodes in the State of Mexico, Hidalgo, Morelos, and Mexico City were analyzed using RT-PCR for the detection of CCV-1 with the CCV1-F/R primers, aiming to determine their presence or absence.

Transmission electron microscopy. In order to ascertain the presence of virions from the viruses identified in the HTS results, symptomatic vegetable prickly pear cactus plants were utilized to prepare 300-mesh copper grids coated with Formvar for observation. The “leaf dip” technique was employed, and 2% phosphotungstic acid served as the contrast agent. The grids were examined using a FEI Tecnai G2 Spirit TWIN transmission electron microscope at the Electron Microscopy Unit of the College of Postgraduates.

 Results

Virus Detection by HTS. A total of 32,921,232 reads were obtained for sample EM-1, and 48,292,940 reads for sample CDMX-1. The raw reads have been deposited in NCBI under the BioProject number PRJNA922236. Analysis of these reads revealed the presence of sequences from various viruses and a viroid in the vegetable prickly pear cactus (Table 2), which are described below:

Comparison of the complete or partial genome of the viruses identified through HTS in the two vegetable prickly pear cactus libraries with the most closely related reference sequence from GenBank.
Sample Virus/Viroid isolation detected GenBank accession number Part of the genome Reference sequence accession number Percent nucleotide similarity
EM-1 CCV-1-Edo-MeX OQ240442 Complete KU854930.4 87.71
OV2-Edo-Mex OQ240440 Complete NC_040685.2 97.67
CCV-1-CD-MX OQ240444 Partial KU854930.4 97.5
CDMX-1 OV2-CDMX OQ240441 Complete NC_040685.2 97.61
Opuntia virus A OQ240443 Complete LC654699.2 74.42
Opuntia viroid I OQ240445 Complete X95292.1 88.52*

*Query coverage 14%.

Opuntia virus 2. The presence of the virus was detected and confirmed in the two samples subjected to HTS, resulting in two complete genomes named OV2-Edo- Mex and OV2-CDMX. The average coverage per nucleotide was 634,104.1X and 500.5X, respectively (Figure 2A, 3A). The 6,453 nt OV2-Edo-Mex genome exhibits the typical organization of tobamoviruses (Figure 2B), including a 5’ untranslated region (UTR) (nt 1-57), an open reading frame (ORF) encoding the 183 kDa viral replicase (RdRp) (nt 58-4,854), a 128 kDa methyltransferase/helicase (nt 67-3,360), a movement protein (MP) (nt 4,844-5,608), a coat protein (CP) (nt 5,514-6,167), and a 3’ UTR (nt 6,168-6,453). The OV2-Edo-Mex genome shares a nucleotide identity of 97.6% with the NC_040685.2 OV2 isolate (Table 2).

The genome of the OV2-CDMX isolate had a length of 6,453 nt, displaying a typical tobamovirus organization (Figure 3B) that includes a 5’ untranslated region (UTR) (nt 1-61), an open reading frame (ORF) encoding the 183 kDa RdRp (nt 62- 4,858), a 128 kDa methyltransferase/helicase (nt 62-3,364), MP (nt 4,848-5,612), CP (nt 5,632-6,171), and a 3’ UTR (nt 6,172-6,453). The genome sequence of this isolate shared a nucleotide identity of 97.61% with the NC_040685.2 OV2 isolate (Table 2). Phylogenetic analysis placed both OV2 isolates obtained in this study within the subgroup of tobamoviruses that infect cacti (Figure 4).

(A) Read coverage across the genome of the OV2-Edo-Mex isolate and the percentage of guanine-cytosine content, (B) Genomic map of OV2-Edo-Mex. The arrow indicates the termination codon site of the complete 128 kDa protein, with readthroughs.

Cactus carlavirus 1 (CCV-1). The virus was detected in both samples subjected to HTS. However, the complete genome was only recovered from the State of Mexico sample, supported by an average coverage per nucleotide of 15,516X (Figure 5A). The CCV-1 genome organization is similar to other known carlaviruses, featuring six ORFs (Figure 5B): ORF1 (nt 61-5,880) encodes a polyprotein (220 kDa) involved in viral replication; ORF2 (TGB1) (nt 5,910-6,599), ORF3 (TGB2) (nt 6,577-6,897), and ORF4 (TGB3) (nt 6,879-7,067) encode three proteins of 26 kDa, 11 kDa, and 7 kDa, respectively, representing the movement-associated triple gene block (TGB) proteins associated with ‘potex-like’ cell-to-cell movement (Morozov and Solovyev, 2003); ORF5 (nt 6,866-8,011) encodes a protein with a carlavirus- typical coat protein (CP) domain and a Flexi_CP domain; ORF6 (nt 8,004-8,324) encodes a 12 kDa nucleic acid binding (NB) protein; and finally, the 5’ UTR (nt 1-60) and 3’ UTR (8,325-8,395) regions. Phylogenetic analysis grouped CCV-1- Edo-Mex with the two available genomes of this virus in GenBank (Figure 6) with a nucleotide similarity of 87.86 and 90.41%.

(A) Read coverage across the genome of the OV2-CDMX isolate and the percentage of guanine-cytosine content. (B) Genomic map of OV2-CDMX. The arrow indicates the termination codon site of the complete 128 kDa protein, with readthroughs.

Opuntia potexvirus A (OPV-A). In the composite sample from Mexico City, a 6,671 nt contig was detected, which in the BLASTx search showed 77.5% identity with Schlumbergera virus X (SchVX). Additional inspection of the viral genome transcription and curation through interactive mapping of filtered reads resulted in a consolidated viral sequence of 6,644 nt supported by 10,536,601 reads with an average coverage per nucleotide of 238,206.9X (Figure 7A). The genome is organized into five ORFs (Figure 7B). Like other potexviruses, ORF1 (nt 85-4737) encodes the viral replicase consisting of 1,550 amino acids (aa). It also includes a set of three partially overlapping ORFs: ORF2 (4,737-5,426 nt), ORF3 (5,389- 5,721 nt), and ORF4 (5,651-5,842 nt), displaying the typical configuration of the three-gene block (TGB) of potexviruses. ORF5 (5,854-6,531 nt) encodes the coat protein (CP). Finally, UTR regions of 84 and 113 nt were detected at the 5’ and 3’ ends, respectively.

Conserved amino acid motifs QDGAML, HQQAKDE, and TFDANTE were identified in the C-terminal region of the viral replicase (Van der Vlugt and Berendsen, 2002). Additionally, a catalytic replicase domain containing the characteristic

Maximum Likelihood phylogenetic tree of the Tobamovirus genus showing the relationships between genomes obtained in this study (in bold) for OV2 and those of previously reported isolates. Different colors represent botanical families as natural hosts where each virus has been reported. Circles on branches indicate UFBoot support values > 70%.

central consensus motif TGX3TX3NTX22GDD found in potexviruses (Martelli et al., 2007) was present near the C-terminal end of the replicase. Furthermore, the hexanucleotide motif 5’-GGAAAA-3’ was found at the 5’-UTR, which is observed in some potexviruses (Chen et al., 2005), along with a putative polyadenylation signal at the 3’-UTR.

Pairwise comparisons revealed amino acid identities ranging from 59.8 to 82.2% for the CP and from 53.6 to 77.7% for the viral replicase (Figure 8a, b). The species demarcation criterion for potexviruses states that distinct species have <72% nt or <80% aa identity for the replicase or coat protein genes, respectively (Adams et al., 2004). Therefore, the virus detected in the vegetable prickly pear cactus is considered a new species of the genus Potexvirus, proposed to be named “Opuntia potexvirus A” (OPV-A). The genome sequence of OPV-A has been deposited in GenBank under the accession number OQ240443.

(A) Read coverage across the genome of the CCV-1-Edo-Mex isolate and the percentage of guanine-cytosine content. (B) Genome organization of CCV1-Edo-Mex, depicting six open reading frames and their corresponding products. RNA-dependent RNA polymerase (RdRp); coat protein (CP); nucleic acid-binding protein (NB); triple gene block (TGB).

The phylogenetic trees based on amino acid sequences of the viral replicase and coat protein of viruses belonging to the Alfaflexiviridae family show that OPV-A groups with potexviruses: Pitaya virus X (PiVX), Zygocactus virus X (ZyVX), Cactus virus X (CVX), SchVX, and Opuntia virus X (OpVX), in a highly supported clade (Figures 9 and 10).

Opuntia viroid I. In sample CDMX-1, a contig similar to that of viroids in the family Pospiviroidae was identified and designated as “Opuntia viroid I” (OVd-I). BLASTn analysis results indicated similarity to Columnea latent viroid-B, with a 14% query coverage and an E value of 4e-08. To determine the genus of OVd-I, manual inspection and sequence curation were performed. A final contig of 412 bp was obtained, and mapping onto HTS data confirmed its presence with an average coverage per nucleotide of 1,492X. Confirmation of OVd-I was achieved through RT-PCR and Sanger sequencing.

The secondary structure prediction of OVd-I revealed a rod-shaped molecule with a conserved central region (CCR) (Figure 11), a key criterion for classifying

Maximum Likelihood phylogenetic tree of complete nucleotide sequences of CCV-1 genomes from this study (in bold), along with other isolates, and various species within the Carlavirus genus. Apricot vein clearing associated virus, Prunevirus genus, was used as an outgroup. Circles on branches indicate UFBoot support values > 50%.

a viroid as a new member of the family Pospiviroidae. The presence of CCR and a conserved terminal region (TCR) was considered to place OVd-I within the genus Apscaviroid (Di Serio et al., 2014). No changes were detected in the TCR; however, in the upper CCR, five changes (T/G, T/C, T/G, A/G, G/C) were observed, and in the lower CCR, six changes (G/T, T/C, G/C, C/A, G/C, A/C) were detected, likely due to the divergence of OVd-I from the Apscaviroid genus.

The results of the Maximum Likelihood phylogenetic analysis (Figure 12) placed OVd-I in the clade of the Apscaviroid genus within the Pospiviroidae family. The SDT analysis, based on pairwise comparisons, shows that none of the analyzed viroid sequences exhibit more than 80% similarity with the genome of OVd-I (Figure 13). Finally, OVd-I was detected in all four independent samples from Mexico City and in a sample from Morelos.

(A) Read coverage across the genome of <italic>Opuntia potexvirus A</italic> (OPV-A) and guanine/ cytosine percentage. (B) Genome organization of OPV-A, displaying five open reading frames and their corresponding products: RdRp, viral replicase; TGB, triple gene block; CP, coat protein.

Matrix of amino acid identity percentage for the coat protein (A) and viral replicase (B) of species within the Potexvirus genus closest to <italic>Opuntia potexvirus A</italic> (in bold).

Maximum Likelihood phylogenetic tree of the Alphaflexiviridae family based on viral replicase amino acid sequences; the <italic>Opuntia potexvirus A</italic> sequence is highlighted in bold. Tree colors rep- resent different genera within this family. Circles on branches indicate UFBoot support values >70%.

Other Viruses Detected. Additionally, in sample CDMX-1, additional viral contigs were detected (Table 3). However, only one caulimovirus and one vityvirus were confirmed by RT-PCR. Therefore, it is necessary to proceed with additional efforts to recover the complete genomes of these potential new virus species.

CCV-1 Detection. CCV-1 was detected in all four entities under investigation in 72% of the analyzed samples (Table 4); this marks the initial documentation of CCV-1 presence in commercial vegetable prickly pear cactus plantations in Mexico.

Electron microscopy. In the analyzed samples, virions of various sizes and shapes were observed (Figure 14). Rigid rod-shaped particles, approximately 300 nm in length and 18 nm in diameter characteristic of tobamoviruses were identified.

Maximum Likelihood phylogenetic tree of the Alphaflexiviridae family based on amino acid se-- quences of the coat protein; the <italic>Opuntia potexvirus A</italic> sequence is highlighted in bold. Tree colors represent different genera within this family. Circles on branches indicate UFBoot support values >70%.

Additionally, flexible rod-shaped virions, with an average length of 700 nm and a diameter of 15 nm, were found, possibly associated with CCV-1. Furthermore, flexible viral particles of approximately 500 nm in length were also observed.

 Discussion

In recent years, high-throughput sequencing (HTS) has facilitated the discovery of new viral species (Maliogka et al., 2018; Villamor et al., 2019). This has, in turn, revealed the intricacies of viromes, highlighting their complexity (Al Rwahnih et al., 2011; Vučurović et al., 2021).

Predicted secondary structure using the UNAFold web server (UNAFold tool available online: www. mfold.org) for OVd-I. Highlighted are the sites forming the terminal conserved region (TCR) at positions 16 to 26 and the central conserved region (CCR) at positions 84 to 100 and 313 to 329.

Maximum Likelihood phylogenetic tree of the Pospiviroidae and Avsunviroidae families based on nucleotide sequences of complete genomes from representative species of different genera. The sequence obtained from OVd-I is highlighted in bold. Various colors represent viroid genera. Circles on branches indicate UFBoot support values >50%.

Pairwise identity frequency distribution obtained using the Sequence Demarcation Tool (SDT) (<xref ref-type="bibr" rid="B28">Muhire <italic>et al</italic>., 2014</xref>) from complete genome sequences of <italic>Pospiviroidae</italic> family species to support the demarcation of <italic>Opuntia viroid I</italic> as a new species.

In Mexico, research has been conducted to identify viruses associated with vegetable prickly pear cactus showing putative symptoms of virosis. However, conventional techniques such as RT-PCR, ELISA, transmission electron microscopy, and biological indexing have, in several studies, faced challenges in determining the associated virus or viruses due to their inherent limitations (De La Torre-Almaraz et al., 2007; De La Torre-Almaraz et al., 2016a; De La Torre- Almaráz et al., 2016b; Alonso-Barrera et al., 2015). The use of HTS allows for the identification of all viruses (known or unknown) present in a sample, a capability

Result of Blastx analysis for potentially present viruses in the CDMX-1 library, confirmed through RT-PCR and se--quencing.
Virus Contig length (nucleotide) Reference sequence accession number Identity percentage (query coverage) Part of the genome Confirmation by RT-PCR Confirmation by Sanger sequencing
Caulimovirus 3168 QYR69113.1 47.14 (51) Putative viral replicase + +
Vityvirus 1242 AVL25840.1 52.21 (64) Movement protein + +
Alphavirus 2932 QYD13417.1 75 (27) Coat protein - -
Bammivirus 2110 UUL90866.1 39.75 (99) Viral replicase - -
Betaflexiviridae (Tymovirales) 1096 AZM69108.1 36.36 (52) Three-gene block protein 1 - -

+= Positive; -= Negative

Detection of CCV-1 in four vegetable prickly pear cactus producing states in Mexico.
State Samples analyzed CCV-1 positive samples (%)
Estado de México 24 22 (91)
Morelos 26 16 (64)
Hidalgo 24 10 (41)
CDMX 55 45 (81)
Total 129 93 (72)

not shared by other techniques. For instance, this approach successfully detected a new tobamovirus (OV2) in a sample composed of RNA extracted from O. ficus- indica and O. albicarpa collected in the State of Mexico (Salgado-Ortíz et al., 2020).

This study reveals, for the first time, the virome of commercially grown vegetable prickly pear cactus in the central region of Mexico, comprising three viruses (two of which are new, belonging to the genera Potexvirus and Carlavirus) and one viroid (genus Apscaviroid).

Opuntia potexvirus A (OPV-A) is proposed as a new member of the family Alphaflexiviridae, genus Potexvirus, based on the species demarcation criteria for this genus (Jan et al., 2020). Potexviruses have elongated particles approximately 700 nm in length, infect herbaceous hosts, lack known vectors, and are primarily transmitted mechanically (Jan et al., 2020). Phylogenetically, OPV-A is closely related to PiVX and SchVX, which naturally infect cacti (Figures 9 and 10).

Recently, potexviruses CVX, OpVX, PiVX, SchVX, and ZyVX were reported in ornamental cacti, either as single infections or mixed infections with up to four

Viral particles in the form of rigid rods (®) and flexible filaments (®) of varying lengths were observed through transmission electron microscopy in vegetable prickly pear cactus exhibiting irregular yellow patterns, yellow rings, mosaic patterns, and chlorotic spots around the spines, employing the “leaf dip” technique.

of them (CVX, PiVX, SchVX, and ZyVX) in a single plant (Park et al., 2021). Additionally, it was noted that the cactus Notocactus leninghausii f. cristatus can be co-infected with up to six viruses, including four potexviruses (CVX, PiVX, SchVX, and ZyVX) and two tobamoviruses (CMMoV and RCNaV) (Park et al., 2018). These reports highlight cacti as natural hosts for both potexviruses and tobamoviruses. However, the symptoms caused by these viruses individually have not been clearly described, and their host range is not well-known. Therefore, future studies will need to address the biological characterization of the potexvirus detected in this study to determine, among other things, whether it poses a risk to prickly pear cactus production in Mexico.

In the HTS analysis, CCV-1 was detected in samples from both Mexico City and the State of Mexico. However, the complete genome was only recovered from the cladodes collected in the latter. The partial genome detection in the Mexico City sample is likely attributed to the suppression of CCV-1 replication by OPV-A and OV2. Consequently, the number of sequences obtained for CCV-1 did not cover the entire genome. The CCV-1 isolated from the State of Mexico grouped in the same clade as the MK415316.1 isolate reported in the United States and a sequence from Mexico (KU854930.4) but in a distinct branch. This virus was detected in all four sampled entities (Table 4), both in plants exhibiting virosis symptoms and asymptomatic plants, the latter case only in the states of Hidalgo, Morelos, and Mexico City. Carlaviruses are known to be transmitted by non-persistent aphids or whiteflies, predominantly infect herbaceous plants, and many cause latent or asymptomatic infections, explaining their detection in asymptomatic prickly pear cactus without visible alterations (Kreuze et al., 2012). CCV-1 and cactus carlavirus 2 (CC-2) were first detected in an asymptomatic ‘Professor Ebert’ hybrid of Epiphyllum spp. (Peng et al., 2019). Therefore, subsequent studies should investigate the biological behavior of both viruses to determine if, under certain environmental conditions, they induce symptoms in vegetable prickly pear cactus and other economically significant plants. Additionally, it needs to be established whether they pose a risk to vegetable prickly pear cactus or other crops in production. OV2 was first reported in Mexico, infecting various cultivated (O. ficus- indica and O. albicarpa) and uncultivated (O. pilifera, O. depressa, O. tomentosa, O. robusta, and O. streptacantha) cactus species in the states of Mexico, Puebla, and Mexico City (Salgado-Ortíz et al., 2020). The Tobamovirus genus is categorized into seven groups based on their natural hosts, including the families Solanaceae, Brassicaceae, Cucurbitaceae, Malvaceae, Cactaceae, Passifloraceae, Apocynaceae, and Leguminosae (Li et al., 2017; Song et al., 2006). The phylogenetic analysis is consistent with this classification, placing OV2 in the clade of tobamoviruses that infect cacti (Figure 4). Another tobamovirus reported in Mexico that infects prickly pear cactus is the Rattail cactus necrosis-associated virus (RCNaV). RCNaV was previously documented in the Axapusco, Otumba, and San Martín de las Pirámides regions of the State of Mexico in prickly pear cactus displaying small yellow rings (De La Torre-Almaráz et al., 2016a). However, RCNaV was not detected in any of the samples analyzed by HTS in this study.

This research reports, for the first time worldwide, the presence of a viroid in vegetable prickly pear cactus (OVd-I). However, since it was found in samples with mixed infections involving OV2, CCV-1, and OPV-A, it remains unknown whether it induces symptoms individually.

Currently, there is no regulatory framework in Mexico governing the movement of prickly pear cactus propagative material. Consequently, there is a risk of introducing the viruses and viroid identified in this study to new production areas of this species.

 Conclusions

The virome of commercially grown vegetable prickly pear cactus in four central Mexico production zones consisted of Opuntia virus 2 (genus Tobamovirus), Cactus carlavirus 1 (genus Carlavirus), a new virus proposed to be named Opuntia potexvirus A (genus Potexvirus), and a new viroid suggested to be named Opuntia viroid I (genus Apscaviroid). Cactus carlavirus 1 was detected in all four sampled states known for vegetable prickly pear cactus production.

 Acknowledgments

We would like to express our gratitude to the National Council of Humanities, Science, and Technology for the scholarship awarded to the first author to pursue doctoral studies. Special thanks to the vegetable prickly pear cactus producers from various states who generously granted access to their plots for sample collection.