rmfi Revista mexicana de fitopatología Rev. mex. fitopatol 0185-3309 2007-8080 Sociedad Mexicana de Fitopatología A.C. 10.18781/R.MEX.FIT.2308-2 00008 Artículos de revisión Aspectos moleculares de la biosíntesis de la faseolotoxina producida por Pseudomonas syringae pv. Phaseolicola Chacón-López Alejandra 1 Hernández-Flores José Luis 2 Montalvo-González Efigenia 1 Aguilera-Aguirre Selene 1 Laboratorio Integral de Investigación en Alimentos/Laboratorio de Microbiología, Departamento de Química y Bioquímica, Instituto Tecnológico de Tepic, Avenida Tecnológico No. 2595, Col. Lagos del Country, Tepic, Nayarit, CP 63175, México. Instituto Tecnológico de Tepic Instituto Tecnológico de Tepic 63175 Mexico Departamento de Ingeniería Genética, Centro de Investigación y de Estudios Avanzados Unidad Irapuato, km 9.6 Libramiento Norte Carr. Irapuato-León, Irapuato, Gto., CP 36821, México. Centro de Investigación y de Estudios Avanzados Centro de Investigación y de Estudios Avanzados 36821 Mexico 18 03 2025 Jan-Apr 2025 43 1 RMEXFIT23082 29 08 2024 10 12 2024 Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons RESUMEN

Antecedentes/Objetivo

. La faseolotoxina es producida por uno de los fitopatóge- nos más importantes y estudiados en el área agrícola: Pseudomonas syringae pv. phaseolicola. Esta bacteria causa el tizón de halo, una enfermedad que devasta al cultivo del frijol. El éxito de P. syringae pv. phaseolicola está relacionado con su información genética que le permite sintetizar metabolitos deletéreos para su hos- pedero, como la faseolotoxina. El objetivo de la presente investigación fue analizar la base molecular del mecanismo de acción, la inmunidad, la genética involucrada en la biosíntesis de la faseolotoxina, las estrategias de diagnóstico molecular y las técnicas moleculares desarrolladas en México, para llevar a cabo el manejo del tizón de halo del frijol.

 Materiales y Métodos.

Se realizó la búsqueda y el análisis de la información cien- tífica más relevante respecto a la biosíntesis de faseolotoxina y los estudios molecu- lares de los factores de patogenicidad y virulencia de P. syringae pv. phaseolicola que han contribuido al desarrollo de estrategias moleculares enfocadas en el diag- nóstico y manejo del tizón de halo en frijol.

 Resultados.

P. syringae pv. phaseolicola produce faseolotoxina, que es la respon- sable de la formación del halo clorótico característico del tizón de halo, esta toxina es un inhibidor de la OCTasa, una enzima que participa en la ruta de síntesis de arginina en frijol. Las regiones cromosómicas Pht y Pbo contienen genes involu- crados en la síntesis e inmunidad de la faseolotoxina, y la expresión de estos genes está regulada por el sistema GacS/GacA y la temperatura. La identificación de genes involucrados en la síntesis de factores de patogenicidad y virulencia, como la faseolotoxina, ha permitido el desarrollo de estrategias de diagnóstico y manejo de la enfermedad basadas en la amplificación de ADN y el uso de marcadores mole- culares que facilitan la identificación de cultivares de frijol resistentes al patógeno.

 Conclusión.

Los estudios moleculares han contribuido al entendimiento de cómo el patovar phaseolicola produce faseolotoxina. Esta información ha sido esencial para entender cómo las bacterias han evolucionado de variantes no patogénicas a patogénicas; además, proporcionan información que permite desarrollar nuevas estrategias para un diagnóstico oportuno y contribuyen en las estrategias para el manejo del tizón de halo.

 Palabras clave:

Patogenicidad, Virulencia, Fitotoxinas, Transferencia Horizontal, Regulación genética.

 Introducción

El frijol común (Phaseolus vulgaris) es un cultivo alimenticio y comercial de suma importancia a nivel mundial. Este cultivo se encuentra ampliamente adaptado a ambientes con temperaturas de crecimiento moderadas y su popularidad se origina porque es fácil de producir (Foyer et al., 2016). Actualmente, la calidad, rendimiento y producción de este cultivo se ve afectado por numerosos problemas fitosanitarios, algunos generados por diversos microorganismos, que limitan la calidad de los productos agrícolas y son responsables de cuantiosas pérdidas económicas; además, representan una amenaza significativa para la seguridad alimentaria mundial (Sundin et al., 2016). Dentro de estos microorganismos se encuentra Pseudomonas syringae, uno de los fitopatógenos más importantes para este y otros cultivos como jitomate, kiwi, tabaco, limón, avena, trigo, soya, pepino, arroz, entre otros (Chen et al., 2022). La especie syringae incluye 62 patovares, dependiendo del hospedero al que infectan y entre ellos se encuentran la mayoría de los fitopatógenos del género Pseudomonas (Bull et al., 2010). El éxito de un fitopatógeno para infectar, colonizar e inducir una serie de síntomas en su hospedero, está directamente relacionado con su información genética. Esta información, representada por los genes, le permite sintetizar y secretar metabolitos deletéreos para la planta (Lamichhane et al., 2015). Los diversos patovares de P. syringae son reconocidos por producir un amplio espectro de metabolitos que actúan como factores de patogenicidad y virulencia; entre ellos se encuentran las fitotoxinas, que dañan directamente las células de las plantas e influyen en el desarrollo de la enfermedad. P. syringae pv. phaseolicola, es el agente causal de la enfermedad del

tizón de halo del frijol, la cual puede ser devastadora, especialmente cuando persisten las condiciones ambientales adversas. La presencia de un halo clorótico que caracteriza a esta enfermedad es justamente ocasionada por la faseolotoxina, una fitotoxina producida por P. syringae pv. phaseolicola (Arrebola et al., 2011). La genética relacionada con la síntesis de las fitotoxinas ha cobrado notable importancia, ya que los genes que codifican para las enzimas involucradas en el ensamblaje, la maduración e incluso, las necesarias para la secreción, se encuentran agrupados en fragmentos cromosómicos conocidos como islas genómicas. Estas islas contienen todos los elementos necesarios para transferirse de manera horizontal entre los diferentes patovares. Esto es de gran relevancia, dado que a través de estos mecanismos de transferencia genética, las bacterias adquieren nuevas habilidades patogénicas (Melnyk et al., 2019). El avance en el estudio genético de los factores de patogenicidad y virulencia, como son las fitotoxinas, favorece la comprensión de cómo los patógenos adquieren y producen el arsenal molecular necesario para el desarrollo de las enfermedades en los sistemas vegetales (Ichinose et al., 2013). Considerando que cada patovar de P. syringae produce una diversidad de fitotoxinas, esta revisión se enfocará en el análisis uno de esos casos: la genética involucrada en biosíntesis de la faseolotoxina producida por el patovar phaseolicola y su participación en el desarrollo del tizón de halo del frijol. Esta información contribuye esencialmente al entendimiento de cómo esta bacteria fitopatógena ha adquirido genes necesarios para sintetizar la faseolotoxina y cómo ha coordinado su sistema de regulación endógeno para este propósito. Adicionalmente, se analiza el potencial que han tenido este tipo de estudios genéticos para el desarrollo de es-

trategias destinadas al diagnóstico y manejo oportuno de las enfermedades.

<italic>P. syringae pv. phaseolicola</italic>

El tizón de halo es una de las principales enfermedades que afecta al cultivo de frijol y es causada por la bacteria P. syringae pv. phaseolicola. Esta bacteria persiste en la semilla y se activa después de su germinación; puede sobrevivir como parásito dentro del tejido vegetal y como epífita sobre la superficie de las hojas. La bacteria se ha observado en la mayoría de las regiones productoras de frijol en todo el mundo y se ha convertido en un fitopatógeno altamente destructivo para este cultivo, generando pérdidas que oscilan entre el 50 y 100 % de la producción (Arnold et al., 2011; Lépiz-Ildefonso et al., 2015). La bacteria se puede presentar en los diferentes estados fenológicos afectando hojas, tallo, vainas y semillas. En hojas, se observa la aparición pequeñas lesiones acuosas que posteriormente se vuelven necróticas; aproximadamente una semana después de la infección, una o más lesiones son rodeadas por un halo clorótico (Figura 1A y B). También en las vainas se desarrollan lesiones acuosas y hundidas de color marrón rojizo (Figura 1

Síntomas producidos por <italic>P. syringae</italic> pv. <italic>phaseolicola</italic> en el frijol. A y B, Síntomas en las hojas. C y D, Síntomas en las vainas. Fuente: Adaptada de Schwartz, 2008; Harveson, 2009.

C y D). Las infecciones de las vainas pueden transferirse a las semillas, causando que se contraigan, decoloren o sean más pequeñas de lo normal. La bacteria se desarrolla en un rango de 28-30 °C con una humedad relativa mayor al 80 %; sin embargo, a temperaturas que oscilan entre los 18 y 20 ºC se presentan síntomas más severos. El descenso de la temperatura induce la producción de faseolotoxina, que es la responsable de la formación del halo clorótico y del amarillamiento característico que se observa durante el desarrollo de la enfermedad (Arnold et al., 2011; Xin et al., 2018).

 <italic>La faseolotoxina y su mecanismo de acción</italic>

Desde el punto de vista químico, la estructura de la faseolotoxina es inusual y tiene dos componentes distintos: un residuo inorgánico, Nδ(N’-Sulfodiaminofosfinil) y un tripéptido, L-ornitil-alanil-homoarginina (Figura 2) (Arrebola et al., 2011). Esta toxina actúa como un inhibidor reversible de la enzima ornitina carbamoiltransferasa (OCTasa EC 2.1.3.3.), codificada por el gen argF. La OCTasa cataliza la conversión de ornitina y carbamoilfosfato a citrulina en la ruta de la síntesis

Estructura de la faseolotoxina y PSOrn, producto de la degradación de la faseolotoxina por peptidasas de la planta.

de arginina. Dentro de la célula vegetal, la faseolotoxina se hidroliza por la acción de peptidasas para producir Nδ-(N´-sulfodiaminofosfinil)-L-ornitina (denominada octicidina o PSOrn), que es un inhibidor irreversible de la OCTasa y que es la forma predominante en la que se encuentra la toxina en plantas de frijol infectadas (Sawada et al., 2002). Esta inhibición provoca una acumulación de ornitina y una deficiencia de arginina. A medida que la toxina se difunde a través del tejido foliar, altera la síntesis de la clorofila, causando clorosis e inhibición del crecimiento en tejidos vegetales y finalmente, ocasiona la muerte de las células del huésped. Adicionalmente, la invasión sistémica de la planta se ve facilitada por el efecto de la faseolotoxina, de manera que contribuye significativamente a la virulencia del patógeno (Arnold et al., 2011).

Originalmente, la faseolotoxina se consideró restringida a P. syringae pv. phaseolicola; sin embargo, también es producida por el patovar actinidiae que infecta al kiwi (Actinidia chinensis) (Fujikawa y Sawada, 2019), y por una cepa del patovar syringae, aislada de Vicia sativa (Tourte y Manceau, 1995). Diversos aislamientos pertenecientes al patovar phaseolicola sintetizan faseolotoxina cuando se cultivan a 18-20 °C, aunque su grado de producción puede variar entre aislamientos. Por otro lado, también se han identificado cepas pertenecientes al patovar phaseolicola que son incapaces de producirla, ya que carecen de todos o parte de los genes necesarios para su síntesis (Gonzalez et al., 2003).

 <italic>Inmunidad a la faseolotoxina</italic>

Inicialmente, fue un misterio determinar cómo P. syringae pv. phaseolicola era inmune a su propia toxina. El efecto tóxico de la faseolotoxina era evidente ya que no solo inhibe a la OCTasa del frijol, sino a una gran variedad de OCTasas vegetales y bacterianas e incluso de mamíferos (Bender et al., 1999). En estos organismos

causa un fenotipo de auxotrofía a arginina, que es aliviado añadiendo arginina o citrulina al medio de cultivo. En contraste, cepas de P. syringae pv. phaseolicola productoras de faseolotoxina, son insensibles a su toxina y no requieren de suplementos de arginina o citrulina. Todo se esclareció cuando se identificó y caracterizó el gen argK, que codifica para una OCTasa resistente a la faseolotoxina (Mosqueda et al., 1990). De esta manera, se observó que P. syringae pv. phaseolicola presenta dos actividades de OCTasa, una sensible a la toxina que se produce a 28 °C y, la actividad de la OCTasa resistente, que garantiza el suministro óptimo de la arginina requerida para el crecimiento bacteriano, bajo las condiciones de síntesis de faseolotoxina (Lopez-Lopez et al., 2004). El conocimiento acerca de la resistencia bacteriana al efecto de sus toxinas se ha utilizado en varias estrategias para desarrollar plantas resistentes. Para el caso de la faseolotoxina, argK ha sido utilizado como transgen en plantas de tabaco (Nicotiana tabacum) y ha tenido éxito en el desarrollo de plantas resistentes al efecto de la faseolotoxina (De la Fuente-Martinez et al., 1992). Estudios como estos pueden extrapolarse a otros cultivos de interés agronómico, permitiendo generar cultivares resistentes al ataque de los patógenos.

 <italic>La genética detrás de la biosíntesis de faseolotoxina</italic>

Diversos estudios se han enfocado en la química de la faseolotoxina, el modo de acción y su contribución a la patogenicidad, pero se sabe poco sobre su biosíntesis. A través de los análisis genéticos, se ha aportado información relevante para dilucidar cómo se sintetiza esta toxina. El primer indicio de los genes involucrados en la síntesis fue la identificación y caracterización de amtA y desI, estos genes codifican para una amidinotransferasa y una desaturasa de ácidos grasos, respectivamente (Hernandez-Guzman y Alvarez-Morales, 2001; Zhang y Patil, 1997). Actualmente, se cuenta con la descripción y el análisis de una región de 30,245 pb del cromosoma de P. syringae pv. phaseolicola NPS3121, denominada Región Pht (Figura 3A), la cual contiene 23 genes necesarios para la síntesis de faseolotoxina, incluyendo los genes argK, amtA y desI (Aguilera et al., 2007). La Región Pht está delimitada por secuencias de inserción y transposasas, sugiriendo que este fragmento constituye una isla genómica que pudo ser adquirida a través de eventos de transferencia horizontal (Murillo et al., 2011). La función precisa de los genes codificados dentro de la región Pht permanece incierta y solamente algunos de estos genes han sido estudiados más a fondo (Aguilera et al., 2012; Arai y Kino, 2008; Chen et al., 2015; Gonzalez-Villanueva et al., 2014). De esta manera, ha sido posible asignarles una función en el proceso de síntesis y regulación de la faseolotoxina (Cuadro 1).

La faseolotoxina se compone de un tripéptido y se ha propuesto que su síntesis es

a través de un mecanismo denominado síntesis no ribosómica de péptidos. En este proceso participan complejos enzimáticos como las péptido sintetasas no ribosomales (NRPS; por sus siglas en inglés, Non-ribosomal Peptide Synthetases) y/o las

Representación gráfica de las Regiones Pht y Pbo en el cromosoma de <italic>P. syringae</italic> pv. <italic>phaseolicola.</italic> A, Operones de la Región Pht. B, Operones de la Región Pbo. Cada flecha representa cada gen, la dirección de la flecha indica la dirección de la transcripción.

Función de genes <italic>pht</italic> involucrados en la síntesis de faseolotoxina.
Gen Proteína codificada Función Referencia
argK Ornitina carbamoil transferasa Catalizar la reacción entre el carbamoil fosfato y la ornitina para formar citrulina bajo condiciones de síntesis de faseolotoxina. Lopez-Lopez et al., 2004
amtA Amidinotransferasa Catalizar la reacción de transferencia reversible de grupos amidino para sintetizar L-homoarginina. Hernandez-Guzman y Alvarez-Morales, 2001
desI Desaturasa de ácidos grasos Deshidrogenar ácidos grasos, creando dobles enlaces entre carbono-carbono; percepción de la temperatura. Zhang y Patil, 1997
phtU L-aminoácido ligasa Catalizar la condensación de aminoácidos. Arai y Kino, 2008
phtQ Péptido ligasa Catalizar la formación de enlaces peptídicos. Chen et al., 2015
phtL Piruvatofosfato dicinasa Transferir grupos fosfato del pirofosfato y del fosfoenolpiruvato a una molécula de AMP para sintetizar ATP, fosfato y piruvato. Gonzalez-Villanueva et al., 2014
phtA Nucleósido trifosfato hidrolasa Hidrolizar el enlace beta-gamma fosfato de un nucleósido trifosfato. Aguilera et al., 2012

policétido sintetasas (PKS, por sus siglas en inglés, Polyketide Synthases). El gen PSPPH_4550, identificado como una NRPS, participa en la síntesis de faseolotoxina (De la Torre-Zavala et al., 2011). De manera interesante, el gen PSPPH_4550 se encuentra codificado fuera de la Región Pht y es parte de otra isla genómica,

denominada Región Pbo. Este fragmento contiene 16 genes (Figura 3B) y algunos de ellos, codifican para NRPS o PKS (Cuadro 2), sugiriendo su participación en la síntesis del tripéptido (Guardado-Valdivia et al., 2021).

Predicción de la función de genes <italic>pbo</italic> involucrados en la síntesis de faseolotoxina.
Gen Proteína codificada Función Referencia
pboO Sintetasa c Formar enlaces amida en el proceso de síntesis de péptidos no ribosomales. Guardado-Valdivia et al., 2021
pboM Cetoacil transferasa Catalizar las elongaciones de ácidos grasos en la síntesis de policétidos. Guardado-Valdivia et al., 2021
pboA Enzima de unión a AMP Condensar y adenilar en el proceso de síntesis de péptidos no ribosomales. De la Torre-Zavala et al., 2011
pboB Cetoacil sintasa Catalizar la condensación de Claisen descarboxiladora de ácidos grasos en la síntesis de policétidos. Guardado-Valdivia et al., 2021
pboC Dominio de unión de fosfopanteína Unir aminoácidos y ácidos grasos activados en la síntesis de péptidos no ribosomales. Guardado-Valdivia et al., 2021

A la fecha, múltiples genes involucrados en la síntesis de faseolotoxina han sido identificados (Cuadro 1 y 2), y se han asignado funciones a algunos de ellos; sin embargo, aún queda mucho trabajo para dilucidar la función del resto de los genes y especialmente, cuáles son los genes involucrados en sintetizar el componente inorgánico de dicha toxina.

 <italic>Regulación de la síntesis de faseolotoxina</italic>

Es evidente que los fitopatógenos requieren de mecanismos genéticos que les concedan la habilidad de adaptarse en respuesta a las condiciones en las que se encuentran. En bacterias fitopatógenas, los sistemas de regulación de dos componentes permiten la adaptación a diferentes condiciones en respuesta a las señales ambientales, transfiriendo la señal a factores de transcripción, los cuales activan la expresión de genes (Sultan et al., 2021). P. syringae pv. phaseolicola posee diversos sistemas de dos componentes; sin embargo, el sistema GacS/GacA es de gran importancia por su papel en el control de determinantes de virulencia y patogenicidad, adecuación ecológica, sistemas de Quorum sensing (Qs), y la síntesis de diversos metabolitos secundarios (Latour, 2020). El sistema GacS/GacA, controla a todos los genes conocidos hasta ahora, involucrados en la síntesis y regulación de la faseolotoxina en P. syringae pv. phaseolicola NPS3121 (De la Torre-Zavala et al., 2011; Ramirez-Zapata et al., 2020). Otros reguladores globales, como el factor transcripcional IHF, también participa en este proceso. La función de IHF como

regulador de la expresión de factores virulencia ha sido extensamente reportado (Arvizu-Gomez et al., 2011; Reverchon et al., 2021). Estos hallazgos revelan que algunos genes que se adquieren a través de eventos de transferencia horizontal, pueden ser integrados a los sistemas de regulación global preexistentes (RedondoSalvo et al., 2020). En este sentido, los genes involucrados en la biosíntesis de la faseolotoxina no fueron la excepción.

Para P. syringae pv. phaseolicola NPS3121, el descenso de la temperatura también es un factor determinante en la producción de la faseolotoxina. Este cambio controla la transcripción de los genes pht y pbo (Aguilera et al., 2007; GuardadoValdivia et al., 2021). La información recopilada hasta el momento, permite proponer un modelo de señalización y regulación de la biosíntesis de la faseolotoxina en P. syringae pv. phaseolicola NPS3121 (Figura 4), en el cual se representa de manera esquemática el estímulo y la cascada de señalización responsable de desencadenar la síntesis de faseolotoxina.

Modelo de señalización, regulación y efecto de la biosíntesis de la faseolotoxina producida por <italic>P. syringae</italic> pv. <italic>phaseolicola</italic> NPS3121. La temperatura se percibe por el sensor membranal GacS, que como consecuencia se autofosforila (1). GacS fosforilado transfiere el fosfato al regulador de respuesta GacA (2). GacA controla la expresión de los genes <italic>pht</italic>, mediada por el regulador IHF. GacA también controla la transcripción de los genes <italic>pbo</italic> 3). Finalmente, se sintetiza la faseolotoxina, que inhibe a la OCTasa del frijol, impidiendo la síntesis de arginina. Consecuentemente, se desarrolla el halo clorótico.

<italic>Transferencia de las Regiones Pht y Pbo entre patovares</italic>

En bacterias, la transferencia horizontal de genes a través de elementos genéticos accesorios como plásmidos, transposones, profagos o islas genómicas les permite adquirir y expresar genes provenientes de una amplia gama de especies (Carraro et al., 2017). Se ha sugerido que Región Pht constituye una isla genómica que P. syringae adquirió mediante mecanismos de transferencia horizontal. Esto se ha sustentado dada la similitud de la organización y la secuencia de las diferentes versiones de la Región Pht identificadas en los patovares phaseolicola y actinidae, que denotan claramente un origen común y una funcionalidad conservada (Murillo et al., 2011). Adicionalmente, el hallazgo de cepas de P. syringae pv. phaseolicola carentes de la Región Pht, ha dado sustento a esta propuesta (Gonzalez et al., 2003). En lo referente a la Región Pbo, también comprende otra isla genómica. A pesar de que ambas islas participan en la síntesis de la faseolotoxina, no existe una correlación entre la posesión de la Región Pbo y la Región Pht, sugiriendo que su adquisición se llevó a cabo de manera independiente y una vez que fueron adquiridas, se incorporaron en el cromosoma de P. syringae pv. phaseolicola, quedando bajo control de los sistemas de regulación global preexistentes (De la Torre-Zavala et al., 2011; Guardado-Valdivia et al., 2021). Las bacterias patogénicas han evolucionado a partir de organismos relacionados no patogénicos, debido a la adquisición de material genético que codifica para múltiples factores de patogenicidad y virulencia. En lo que se refiere a los patovares de P. syringae, es importante comprender cómo los mecanismos de movilidad genética han contribuido a su patogenicidad y virulencia, porque finalmente, esto es lo que ha convertido a esta especie, en una de las 10 bacterias fitopatógenas más importantes a nivel mundial (Mansfield et al., 2012). En lo que se refiere al patovar phaseolicola, los estudios sobre la genética molecular de su interacción con el frijol y la evolución de su patogenicidad y virulencia, han contribuido con importantes descubrimientos en el campo de las interacciones planta-microorganismo, por lo que actualmente P. syringae pv. phaseolicola es considerada un modelo de estudio de la interacción molecular planta-patógeno (Arnold et al., 2011).

Estrategias de detección molecular de Pseudomonas syringae pv. phaseolicola

Uno de los requerimientos más importantes para manejar las enfermedades en las plantas es la identificación oportuna del agente causal. Actualmente, existen técnicas biotecnológicas que aceleran la obtención de resultados y han permitido la identificación oportuna de bacterias fitopatógenas. Adicionalmente, han complementado los procesos tradicionales de diagnóstico como la examinación visual, cultivo del patógeno, la microscopía y las pruebas de patogenicidad.

En lo que se refiere a la detección e identificación de P. syringae pv. phaseolicola, se han desarrollado diversas estrategias moleculares, con la finalidad de llevar a cabo una detección precisa y oportuna. Dentro de las primeras estrategias reportadas, se encuentran los ensayos de inmunoadsorción ligado a enzima (ELISA, por sus siglas en inglés, Enzyme-Linked Immunosorbent Assay). Los antisueros obtenidos reconocieron de manera específica al patovar phaseolicola, sin mostrar reacción cruzada con otros patovares de P. syringae (Wyatt et al., 1989). En esa misma época, se desarrolló una estrategia basada en la hibridación de sondas de ADN que portaban genes involucrados en la síntesis de la faseolotoxina. Esta técnica permitió la detección e identificación del patovar phaseolicola a partir de semillas y de muestras maceradas de tejidos con lesiones (Schaad et al., 1989).

Con el desarrollo de la reacción en cadena de la polimerasa (PCR, por sus siglas en inglés, Polymerase Chain Reaction), se implementaron estrategias para detectar e identificar múltiples fitopatógenos y P. syringae pv. phaseolicola no fue la excepción. Para esto, se diseñaron oligonucleótidos específicos a partir de las secuencias disponibles de genes involucrados en la biosíntesis de faseolotoxina (MosquedaCano y Herrera-Estrella, 1997; Schaad et al., 1995; Schaad et al., 2007). En el Cuadro 3 se describen algunos de los oligonucleótidos empleados para la identificación y las regiones que amplifican.

Oligonucleótidos usados para identificar cepas de <italic>P. syringae</italic> pv. <italic>phaseolicola</italic> productoras de faseolotoxina.
Nombre Secuencia Blanco Referencia
BRL519 BRL520 TTCATTCAAACCTCGCCCGTGTG TGAAAGGAGCCGCCGAAACTATTG amtA Aguilera et al., 2007
PA5.1 PA3.1 AGCTTCTCCTCAAAACACCTGC TGTTCGCCAGAGGCAGTCATG desI Schaad et al., 1995
62a 63a CAATGAAGATTACAAGCCTG GCTAGCTATCAGGGGACGAC argK Mosqueda-Cano y Herrera-Estrella, 1997
P3004L P3004R CTGTCTGGCAGCCACTACAAAG GGCTGCAAATTGTGGGATTT Región Tox- Rico et al., 2006
AVR1-F AVR1-R CCGCCGTAGCAGGGCTTCAC GGACCAATCTCTTTTCTCAA phtL Gonzalez et al., 2003
PHTE-F PHTE-R AATATAGGCTTCAACTTCCTC CCAGGTCAACTCACTTCCG phtE Gonzalez et al., 2003
P25156 Ptx1I5c GCAAAAACGAAAACACCAGGCT ATCGCGCTGATCCGGAAAGG phtA Aguilera et al., 2017
P12556 P11311 TCCGGTTATCGCTTCAGGTCG GCAGTTTCTGATCTTGGGCCC phtM-N Aguilera et al., 2017

Es importante considerar la existencia de aislados de P. syringae pv. phaseolicola que no producen faseolotoxina y por lo tanto, no se pueden detectar utilizando estos oligonucleótidos (Rico et al., 2006). Además, la producción de faseolotoxina no es una característica específica de patovar phaseolicola, por lo que estos ensayos también podrían detectar otros patovares (Tamura et al., 2002). De acuerdo con esto, se han diseñado nuevas metodologías; por ejemplo, la PCR en tiempo real TaqMan, en la que se emplearon oligonucleótidos específicos, basados en el gen de la recombinasa específica de sitio. A través de esta estrategia se lograron diferenciar entre cepas de P. syringae pv. phaseolicola productoras y no productoras de faseolotoxina (Cho et al., 2010). Otra técnica de amplificación de ADN, conocida como amplificación isotérmica mediada por bucle (LAMP; por sus siglas en inglés, Loop-Mediated Isothermal Amplification), ha sido adaptada para facilitar la caracterización e identificación rápida y específica del patovar phaseolicola (Li et al., 2009). El diagnóstico molecular de P. syringae pv. phaseolicola es fundamental para el manejo eficaz del tizón de halo en cultivos de frijol. Aunque el diagnóstico molecular puede ser más costoso y requiere de infraestructura especializada, su alta precisión, rapidez y capacidad para detectar infecciones de manera temprana y cuantitativa, hacen que sea una herramienta indispensable en la lucha contra este patógeno. Con el tiempo, se espera que las tecnologías de diagnóstico molecular continúen mejorando y se hagan más accesibles, lo que permitirá un manejo más eficiente de las enfermedades bacterianas en la agricultura.

 <italic>Estrategias moleculares para el manejo del tizón de halo del frijol. Una alternativa para la agricultura en México</italic>

En México, el manejo del tizón de halo en frijol se ha convertido en un desafío para los productores debido a la naturaleza agresiva de la enfermedad y la capacidad de propagación rápida (Félix-Gastélum et al., 2016). P. syringae pv. phaseolicola se encuentra ampliamente distribuida en el país (Figura 5), por lo es un riesgo para la producción nacional de frijol (Félix-Gastélum et al., 2016; Jiménez-Hernández et al., 2023; Navarrete y Acosta-Gallegos, 2000; Quiñones-Aguilar et al., 2018). Es por esto que para el manejo del tizón de halo, se han desarrollado estrategias como la aplicación de antibióticos agrícolas, la eliminación de residuos de la cosecha, la rotación de cultivos o el empleo de variedades de frijol resistentes; entre otras (Schwartz et al., 2005). Con la combinación de estas medidas ha sido posible controlar el desarrollo de la enfermedad; sin embargo, no ha sido suficiente.

A partir de los avances en la Biotecnología, las estrategias moleculares han emergido como una herramienta poderosa que pueden complementar las estrategias convencionales y lograr un manejo más eficiente y sostenible de los patógenos. La resistencia genética es una de las estrategias más efectivas para controlar las

Mapa representativo de la distribución de <italic>P. syringae</italic> pv. <italic>phaseolicola</italic> en México. Los estados marcados con color amarillo indican la presencia de esta bacteria.

enfermedades en las plantas. En México, el uso de marcadores moleculares ha favorecido la identificación de variedades de frijol, como Flor de Mayo M38, San Rafael, Pinto Laguna 80 y Pinto Saltillo, que muestran resistencia contra P. syringae pv. phaseolicola (Jiménez-Hernández et al., 2023). A pesar de esto, la resistencia en las variedades comerciales disponibles en México sigue siendo limitada, por lo que el desarrollo de nuevas variedades resistentes, mediante técnicas moleculares novedosas como la edición genética CRISPR/Cas9 (Thomas et al., 2024), podría representar una alternativa para introducir de manera específica, genes de resistencia en las variedades de frijol. Adicionalmente, las tecnologías basadas en las llamadas “ciencias ómicas”, ofrecen información valiosa para comprender la interacción de P. syringae pv. phaseolicola con el frijol. Los análisis proteómicos de las variedades de frijol resistentes al tizón de halo, aportan información para entender la naturaleza de esa resistencia (Cooper et al., 2020; Oblessuc et al., 2022), además de generar información que podría ser utilizada para desarrollo de estrategias de control, basadas en los análisis de marcadores genéticos y proteicos de dichas variedades. El uso de bacteriófagos en el control biológico también es una alternativa prometedora y ecológica para el control de bacterias patógenas. En el 2018, Quiñones-Aguilar y cols., aislaron bacteriófagos nativos del estado de Zacatecas y evaluaron su actividad lítica contra cepas virulentas de P. syringae pv. phaseolico-

la. De esta manera, se identificó un bacteriófago capaz de disminuir hasta un 60% el daño provocado por el patovar phaseolicola en ejotes (Quiñones-Aguilar et al., 2018). En México, las técnicas moleculares enfocadas en el manejo del tizón de halo y demás enfermedades en los cultivos, son limitadas, por lo que es necesario impulsar el desarrollo de nuevas estrategias que complementen el manejo del tizón de halo del cultivo de frijol en la agricultura mexicana.

 Conclusiones

Pseudomonas syringae pv. phaseolicola es una especie bacteriana con gran capacidad patogénica, por tal motivo, se ha convertido en un modelo de estudio para la comprensión de la interacción molecular planta-patógeno. Las regiones Pht y Pbo, que contienen genes involucrados en la biosíntesis de la faseolotoxina, juegan un papel clave en el desarrollo del tizón de halo. Las evidencias sustentan que la adquisición de las regiones Pht y Pbo se llevó a cabo a través de eventos de transferencia horizontal, una actividad común entre los fitopatógenos. De esta manera, adquieren material genético foráneo y lo controlan a través de su sistema de regulación endógeno; que para el caso de los genes pht y pbo, fueron incorporados a la regulación global del sistema de dos componentes, GacS/GacA y del regulador IHF. Para P. syringae pv. phaseolicola, la adquisición de las Regiones Pht y Pbo ha sido un evento favorable, ya que le permitió aumentar su grado de virulencia, de manera que el resultado de esta nueva habilidad es devastar con mayor eficiencia al cultivo de frijol. Los estudios a nivel molecular de los factores de patogenicidad y virulencia de P. syringae pv. phaseolicola, como es el caso de la faseolotoxina, ofrecen información valiosa para el diseño de estrategias de diagnóstico y manejo del tizón de halo. El desarrollo de nuevas estrategias moleculares favorecerá el diagnóstico temprano, la identificación de nuevas cepas patógenas y el desarrollo de cultivos resistentes, lo que a su vez reducirá el impacto económico de las enfermedades en cultivos de importancia agronómica como el frijol.

 Referencias Aguilera, S., De la Torre-Zavala, S., Hernandez-Flores, J. L., Murillo, J., Bravo, J., & Alvarez-Morales, A. (2012). Expression of the gene for resistance to phaseolotoxin (argK) depends on the activity of genesphtABCinPseudomonas syringaepv. phaseolicola. PLoS One, 7(10), e46815. https://doi.org/10.1371/journal.pone.0046815 Aguilera S. De la Torre-Zavala S. Hernandez-Flores J. L. Murillo J. Bravo J. Alvarez-Morales A. 2012 Expression of the gene for resistance to phaseolotoxin (argK) depends on the activity of genes phtABC in Pseudomonas syringae pv. phaseolicola PLoS One 7 10 e46815 10.1371/journal.pone.0046815 Aguilera, S., Lopez-Lopez, K., Nieto, Y., Garciduenas-Pina, R., Hernandez-Guzman, G., Hernandez-Flores, J. L., Murillo, J., & Alvarez-Morales, A. (2007). Functional characterization of the gene cluster fromPseudomonas syringaepv. phaseolicola NPS3121 involved in synthesis of phaseolotoxin. Journal of Bacteriology, 189(7), 2834-2843. https://doi.org/10.1128/JB.01845-06 Aguilera S. Lopez-Lopez K. Nieto Y. Garciduenas-Pina R. Hernandez-Guzman G. Hernandez-Flores J. L. Murillo J. Alvarez-Morales A. 2007 Functional characterization of the gene cluster from Pseudomonas syringae pv. phaseolicola NPS3121 involved in synthesis of phaseolotoxin Journal of Bacteriology 189 7 2834 2843 10.1128/JB.01845-06 Akbari-Kiarood, S. L., Rahnama, K., Golmohammadi, M., & Nasrollanejad, S. (2020). Quorum quenchingendophytic bacteria inhibit disease caused byPseudomonas syringaepv. syringae in Citrus cultivars. Journal of Basic Microbiology, 60(9), 746-757. https://doi.org/10.1002/jobm.202000038 Akbari-Kiarood S. L. Rahnama K. Golmohammadi M. Nasrollanejad S. 2020 Quorum quenching endophytic bacteria inhibit disease caused by Pseudomonas syringae pv. syringae in Citrus cultivars Journal of Basic Microbiology 60 9 746 757 10.1002/jobm.202000038 Arai, T., & Kino, K. (2008). A novel L-amino acid ligase is encoded by a gene in the phaseolotoxin biosynthetic gene cluster fromPseudomonas syringaepv. phaseolicola 1448A. Bioscience, Biotechnology and Biochemistry, 72(11), 3048-3050. https://doi.org/10.1271/bbb.80439 Arai T. Kino K. 2008 A novel L-amino acid ligase is encoded by a gene in the phaseolotoxin biosynthetic gene cluster from Pseudomonas syringae pv. phaseolicola 1448A Bioscience, Biotechnology and Biochemistry 72 11 3048 3050 10.1271/bbb.80439 Arnold, D. L., Lovell, H. C., Jackson, R. W., & Mansfield, J. W. (2011). Pseudomonas syringaepv. phaseolicola: from ‘has bean’ to supermodel. Molecular Plant Pathology, 12(7), 617-627. https://doi.org/10.1111/j.1364-3703.2010.00697.x Arnold D. L. Lovell H. C. Jackson R. W. Mansfield J. W. 2011 Pseudomonas syringae pv. phaseolicola: from ‘has bean’ to supermodel Molecular Plant Pathology 12 7 617 627 10.1111/j.1364-3703.2010.00697.x Arrebola, E., Cazorla, F. M., Perez-Garcia, A., & de Vicente, A. (2011). Chemical and metabolic aspects of antimetabolite toxins produced byPseudomonas syringaepathovars. Toxins, 3(9), 1089-1110. https://doi.org/10.3390/toxins3091089 Arrebola E. Cazorla F. M. Perez-Garcia A. de Vicente A. 2011 Chemical and metabolic aspects of antimetabolite toxins produced by Pseudomonas syringae pathovars Toxins 3 9 1089 1110 10.3390/toxins3091089 Arvizu-Gomez, J. L., Hernandez-Morales, A., Pastor-Palacios, G., Brieba, L. G., & Alvarez-Morales, A. (2011). Integration Host Factor (IHF) binds to the promoter region of thephtDoperon involved in phaseolotoxin synthesis inPseudomonas syringaepv. phaseolicola NPS3121. BMC Microbiology, 11, 90. https://doi.org/10.1186/1471-2180-11-90 Arvizu-Gomez J. L. Hernandez-Morales A. Pastor-Palacios G. Brieba L. G. Alvarez-Morales A. 2011 Integration Host Factor (IHF) binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in Pseudomonas syringae pv. phaseolicola NPS3121 BMC Microbiology 11 90 90 10.1186/1471-2180-11-90 Baltenneck, J., Reverchon, S., & Hommais, F. (2021). Quorum sensing regulation in phytopathogenic bacteria. Microorganisms, 9(2), 239-260. https://doi.org/10.3390/microorganisms9020239 Baltenneck J. Reverchon S. Hommais F. 2021 Quorum sensing regulation in phytopathogenic bacteria Microorganisms 9 2 239 260 10.3390/microorganisms9020239 Bender, C. L., Alarcon-Chaidez, F., & Gross, D. C. (1999). Pseudomonas syringaephytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiology and Molecular Biology Reviews, 63(2), 266-292. https://doi.org/10.1128/MMBR.63.2.266-292.1999 Bender C. L. Alarcon-Chaidez F. Gross D. C. 1999 Pseudomonas syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases Microbiology and Molecular Biology Reviews 63 2 266 292 10.1128/MMBR.63.2.266-292.1999 Bogatzevska, N. (1997). Natural epiphytic survival ofPseudomonas syringaepv. phaseolicola on weeds. Pseudomonas syringae pathovars and related pathogens, 9, 72-76. Springer, Dordrecht. https://doi.org/10.1007/978-94-011-5472-7_14 Bogatzevska N. 1997 Natural epiphytic survival of Pseudomonas syringae pv. phaseolicola on weeds Pseudomonas syringae pathovars and related pathogens 9 72 76 Springer, Dordrecht 10.1007/978-94-011-5472-7_14 Bull, C., De Boer, S., Denny, T., Firraro, G., Fischer-Le Saux, M., Saddler, G. S., Scortichini, M., Stead, D. E., & Takikawa, Y. (2010). Comprehensive list of names of plant pathogenic bacteria, 1980-2007. Journal of Plant Pathology, 92, 551-592. http://www.jstor.org/stable/41998846 Bull C. De Boer S. Denny T. Firraro G. Fischer-Le Saux M. Saddler G. S. Scortichini M. Stead D. E. Takikawa Y. 2010 Comprehensive list of names of plant pathogenic bacteria, 1980-2007 Journal of Plant Pathology 92 551 592 http://www.jstor.org/stable/41998846 Carraro, N., Rivard, N., Burrus, V., & Ceccarelli, D. (2017). Mobilizable genomic islands, different strategies for the dissemination of multidrug resistance and other adaptive traits. Mobile Genetics Elements, 7(2), 1-6. https://doi.org/10.1080/2159256X.2017.1304193 Carraro N. Rivard N. Burrus V. Ceccarelli D. 2017 Mobilizable genomic islands, different strategies for the dissemination of multidrug resistance and other adaptive traits Mobile Genetics Elements 7 2 1 6 10.1080/2159256X.2017.1304193 Chen, H., Chen, J., Zhao, Y., & Liu, F. (2022). Pseudomonas syringaepathovars. Trends in Microbiology, 30(9), 912-913. Chen H. Chen J. Zhao Y. Liu F. 2022 Pseudomonas syringae pathovars Trends in Microbiology 30 9 912 913 Chen, L., Li, P., Deng, Z., & Zhao, C. (2015). Ornithine transcarbamylase ArgK plays a dual role for the self-defense of phaseolotoxin producingPseudomonas syringaepv. phaseolicola. Scientific Reports, 5, 12892. https://doi.org/10.1038/srep12892 Chen L. Li P. Deng Z. Zhao C. 2015 Ornithine transcarbamylase ArgK plays a dual role for the self-defense of phaseolotoxin producing Pseudomonas syringae pv. phaseolicola Scientific Reports 5 12892 12892 10.1038/srep12892 Cho, M. S., Jeon, Y. H., Kang, M. J., Ahn, H. I., Baek, H. J., Na, Y. W., Choi, Y. M., Kim, T. S., & Park, D. S. (2010). Sensitive and specific detection of phaseolotoxigenic and nontoxigenic strains ofPseudomonas syringaepv. phaseolicola by TaqMan real-time PCR using site-specific recombinase gene sequences. Microbiological Research, 165(7), 565-572. https://doi.org/10.1016/j.micres.2009.11.001 Cho M. S. Jeon Y. H. Kang M. J. Ahn H. I. Baek H. J. Na Y. W. Choi Y. M. Kim T. S. Park D. S. 2010 Sensitive and specific detection of phaseolotoxigenic and nontoxigenic strains of Pseudomonas syringae pv. phaseolicola by TaqMan real-time PCR using site-specific recombinase gene sequences Microbiological Research 165 7 565 572 10.1016/j.micres.2009.11.001 Cooper, B., Campbell, K. B., Beard, H. S., Garrett, W. M., & Ferreira, M. E. (2020). The proteomics of resistance to halo blight in common bean. Molecular Plant Microbe Interactions, 33(9), 1161-1175. https://doi.org/10.1094/MPMI-05-20-0112-R Cooper B. Campbell K. B. Beard H. S. Garrett W. M. Ferreira M. E. 2020 The proteomics of resistance to halo blight in common bean Molecular Plant Microbe Interactions 33 9 1161 1175 10.1094/MPMI-05-20-0112-R De la Fuente-Martinez, J. M., Mosqueda-Cano, G., Alvarez-Morales, A., & Herrera-Estrella, L. (1992). Expression of a bacterial phaseolotoxin-resistant ornithyl transcarbamylase in transgenic tobacco confers resistance toPseudomonas syringaepv. phaseolicola. Biotechnology, 10(8), 905-909. https://doi.org/10.1038/nbt0892-905 De la Fuente-Martinez J. M. Mosqueda-Cano G. Alvarez-Morales A. Herrera-Estrella L. 1992 Expression of a bacterial phaseolotoxin-resistant ornithyl transcarbamylase in transgenic tobacco confers resistance to Pseudomonas syringae pv. phaseolicola Biotechnology 10 8 905 909 10.1038/nbt0892-905 De la Torre-Zavala, S., Aguilera, S., Ibarra-Laclette, E., Hernandez-Flores, J. L., Hernandez-Morales, A., Murillo, J., & Alvarez-Morales, A. (2011). Gene expression of Pht cluster genes and a putative non-ribosomal peptide synthetase required for phaseolotoxin production is regulated by GacS/GacA inPseudomonas syringaepv. phaseolicola. Research in Microbiology, 162(5), 488-498. https://doi.org/10.1016/j.resmic.2011.04.010 De la Torre-Zavala S. Aguilera S. Ibarra-Laclette E. Hernandez-Flores J. L. Hernandez-Morales A. Murillo J. Alvarez-Morales A. 2011 Gene expression of Pht cluster genes and a putative non-ribosomal peptide synthetase required for phaseolotoxin production is regulated by GacS/GacA in Pseudomonas syringae pv. phaseolicola Research in Microbiology 162 5 488 498 10.1016/j.resmic.2011.04.010 Félix-Gastélum, R., Maldonado-Mendoza, I. E., Navarrete-Maya, R., Olivas-Peraza, N. G., Brito-Vega, H., & Acosta-Gallegos, A. (2016). Identification ofPseudomonas syringaepv. phaseolicola as the causal agent of halo blight in yellow beans in northern Sinaloa, Mexico. Phytoparasitica, 44, 369-378. https://doi.org/10.1007/s12600-016-0530-5 Félix-Gastélum R. Maldonado-Mendoza I. E. Navarrete-Maya R. Olivas-Peraza N. G. Brito-Vega H. Acosta-Gallegos A. 2016 Identification of Pseudomonas syringae pv. phaseolicola as the causal agent of halo blight in yellow beans in northern Sinaloa, Mexico Phytoparasitica 44 369 378 10.1007/s12600-016-0530-5 Fernandez-Sanz, A., Rodicio, M., & González, A. (2020). Phenotypic and genotypic analysis ofPseudomonas syringaerecovered from symptomatic beans and associated weeds in Northern Spain. European Journal of Plant Pathology, 157, 377-387. https://doi.org/10.1007/s10658-020-02010-z Fernandez-Sanz A. Rodicio M. González A. 2020 Phenotypic and genotypic analysis of Pseudomonas syringae recovered from symptomatic beans and associated weeds in Northern Spain European Journal of Plant Pathology 157 377 387 10.1007/s10658-020-02010-z Fernandez-Sanz, A. M., Rodicio, M. R., & González, A. J. (2016). Pseudomonas syringaepv. phaseolicola isolated from weeds in bean crop fields. Letters in Applied Microbiology, 62(4), 344-348. https://doi.org/10.1111/lam.12556 Fernandez-Sanz A. M. Rodicio M. R. González A. J. 2016 Pseudomonas syringae pv. phaseolicola isolated from weeds in bean crop fields Letters in Applied Microbiology 62 4 344 348 10.1111/lam.12556 Fleitas-Martinez, O., Rigueiras, P. O., Pires, A. D. S., Porto, W. F., Silva, O. N., de la Fuente-Nunez, C., & Franco, O. L. (2018). Interference with Quorum-Sensing signal biosynthesis as a promising therapeutic strategy against multidrug-resistant pathogens. Frontiers in Cellular and Infection Microbiology, 8, 444-451. https://doi.org/10.3389/fcimb.2018.00444 Fleitas-Martinez O. Rigueiras P. O. Pires A. D. S. Porto W. F. Silva O. N. de la Fuente-Nunez C. Franco O. L. 2018 Interference with Quorum-Sensing signal biosynthesis as a promising therapeutic strategy against multidrug-resistant pathogens Frontiers in Cellular and Infection Microbiology 8 444 451 10.3389/fcimb.2018.00444 Foyer, C. H., Lam, H. M., Nguyen, H. T., Siddique, K. H., Varshney, R. K., & Considine, M. J. (2016). Neglecting legumes has compromised human health and sustainable food production. Nature Plants, 2, 16112. https://doi.org/10.1038/nplants.2016.112 Foyer C. H. Lam H. M. Nguyen H. T. Siddique K. H. Varshney R. K. Considine M. J. 2016 Neglecting legumes has compromised human health and sustainable food production Nature Plants 2 16112 16112 10.1038/nplants.2016.112 Fujikawa, T., & Sawada, H. (2019). Genome analysis ofPseudomonas syringaepv. actinidiae biovar 6, which produces the phytotoxins, phaseolotoxin and coronatine. Scientific Reports, 9(1), 3836. https://doi.org/10.1038/s41598-019-40754-9 Fujikawa T. Sawada H. 2019 Genome analysis of Pseudomonas syringae pv. actinidiae biovar 6, which produces the phytotoxins, phaseolotoxin and coronatine Scientific Reports 9 1 3836 3836 10.1038/s41598-019-40754-9 Gonzalez-Villanueva, L., Arvizu-Gomez, J. L., Hernandez-Morales, A., Aguilera-Aguirre, S., & Alvarez-Morales, A. (2014). The PhtL protein ofPseudomonas syringaepv. phaseolicola NPS3121 affects the expression of both phaseolotoxin cluster (Pht) and non-Pht encoded genes. Microbiological Research, 169, 221-231. https://doi.org/10.1016/j.micres.2013.05.002 Gonzalez-Villanueva L. Arvizu-Gomez J. L. Hernandez-Morales A. Aguilera-Aguirre S. Alvarez-Morales A. 2014 The PhtL protein of Pseudomonas syringae pv. phaseolicola NPS3121 affects the expression of both phaseolotoxin cluster (Pht) and non-Pht encoded genes Microbiological Research 169 221 231 10.1016/j.micres.2013.05.002 Gonzalez, A. I., Perez de la Vega, M., Ruiz, M. L., & Polanco, C. (2003). Analysis of the argK-tox gene cluster in nontoxigenic strains ofPseudomonas syringaepv. phaseolicola. Applied and Environmental Microbiology, 69(8), 4979-4982. https://doi.org/10.1128/AEM.69.8.4979-4982.2003 Gonzalez A. I. Perez de la Vega M. Ruiz M. L. Polanco C. 2003 Analysis of the argK-tox gene cluster in nontoxigenic strains of Pseudomonas syringae pv. phaseolicola Applied and Environmental Microbiology 69 8 4979 4982 10.1128/AEM.69.8.4979-4982.2003 Guardado-Valdivia, L., Chacon-Lopez, A., Murillo, J., Poveda, J., Hernandez-Flores, J. L., Xoca-Orozco, L., & Aguilera, S. (2021). The Pbo cluster fromPseudomonas syringaepv. phaseolicola NPS3121 is thermoregulated and required for phaseolotoxin biosynthesis. Toxins, 13(9), 628-648. https://doi.org/10.3390/toxins13090628 Guardado-Valdivia L. Chacon-Lopez A. Murillo J. Poveda J. Hernandez-Flores J. L. Xoca-Orozco L. Aguilera S. 2021 The Pbo cluster from Pseudomonas syringae pv. phaseolicola NPS3121 is thermoregulated and required for phaseolotoxin biosynthesis Toxins 13 9 628 648 10.3390/toxins13090628 Hernandez-Guzman, G., & Alvarez-Morales, A. (2001). Isolation and characterization of the gene coding for the amidinotransferase involved in the biosynthesis of phaseolotoxin inPseudomonas syringaepv. phaseolicola. Molecular Plant-Microbe Interactions, 14(4), 545-554. https://doi.org/10.1094/MPMI.2001.14.4.545 Hernandez-Guzman G. Alvarez-Morales A. 2001 Isolation and characterization of the gene coding for the amidinotransferase involved in the biosynthesis of phaseolotoxin in Pseudomonas syringae pv. phaseolicola Molecular Plant-Microbe Interactions 14 4 545 554 10.1094/MPMI.2001.14.4.545 Ichinose, Y., Taguchi, F., & Mukaihara, T. (2013). Pathogenicity and virulence factors ofPseudomonas syringae. Journal of General Plant Pathology, 79, 285-296. https://doi.org/10.1007/s10327-013-0452-8 Ichinose Y. Taguchi F. Mukaihara T. 2013 Pathogenicity and virulence factors of Pseudomonas syringae Journal of General Plant Pathology 79 285 296 10.1007/s10327-013-0452-8 Jiménez-Hernández, Y., Montero-Tavera, V., Ramírez Pimentel, J. G., Aguirre-Mancilla, C. L., Raya Pérez, J. C., & Acosta-Gallegos, J. A. (2023). Respuesta de cultivares de frijol a inoculación e incidencia natural del tizón de halo y utilidad de marcadores moleculares para selección. Revista Mexicana De Ciencias Agrícolas, 14(8), ME:e3274. https://doi.org/10.29312/remexca.v14i8.3274 Jiménez-Hernández Y. Montero-Tavera V. Ramírez Pimentel J. G. Aguirre-Mancilla C. L. Raya Pérez J. C. Acosta-Gallegos J. A. 2023 Respuesta de cultivares de frijol a inoculación e incidencia natural del tizón de halo y utilidad de marcadores moleculares para selección Revista Mexicana De Ciencias Agrícolas 14 8 ME:e3274 ME:e3274 10.29312/remexca.v14i8.3274 Kashyap, D. R., Wang, M., Liu, L. H., Boons, G. J., Gupta, D., & Dziarski, R. (2011). Peptidoglycan recognition proteins kill bacteria by activating protein-sensing two-component systems. Nature Medicine, 17(6), 676-683. https://doi.org/10.1038/nm.2357 Kashyap D. R. Wang M. Liu L. H. Boons G. J. Gupta D. Dziarski R. 2011 Peptidoglycan recognition proteins kill bacteria by activating protein-sensing two-component systems Nature Medicine 17 6 676 683 10.1038/nm.2357 Lamichhane, J., Messean, A., & Morris, C. (2015). Insights into epidemiology and control of diseases of annual plants caused by thePseudomonas syringaespecies complex. Journal of General Plant Pathology, 81, 331-350. https://doi.org/10.1007/s10327-015-0605-z Lamichhane J. Messean A. Morris C. 2015 Insights into epidemiology and control of diseases of annual plants caused by the Pseudomonas syringae species complex Journal of General Plant Pathology 81 331 350 10.1007/s10327-015-0605-z Latour, X. (2020). The evanescent GacS signal. Microorganisms, 8(11), 1746-1768. https://doi.org/10.3390/microorganisms8111746 Latour X. 2020 The evanescent GacS signal Microorganisms 8 11 1746 1768 10.3390/microorganisms8111746 Li, X., Nie, J., Ward, L., Madani, M., Hsiang, T., Zhao, Y., & De Boer, S. H. (2009). Comparative genomics-guided loop-mediated isothermal amplification for characterization ofPseudomonas syringaepv. phaseolicola. Journal of Applied Microbiology, 107(3), 717-726. https://doi.org/10.1111/j.1365-2672.2009.04262.x Li X. Nie J. Ward L. Madani M. Hsiang T. Zhao Y. De Boer S. H. 2009 Comparative genomics-guided loop-mediated isothermal amplification for characterization of Pseudomonas syringae pv. phaseolicola Journal of Applied Microbiology 107 3 717 726 10.1111/j.1365-2672.2009.04262.x Lopez-Lopez, K., Hernandez-Flores, J. L., Cruz-Aguilar, M., & Alvarez-Morales, A. (2004). InPseudomonas syringaepv. phaseolicola, expression of theargKgene, encoding the phaseolotoxin-resistant ornithine carbamoyltransferase, is regulated indirectly by temperature and directly by a precursor resembling carbamoylphosphate. Journal of Bacteriology, 186(1), 146-153. https://doi.org/10.1128/JB.186.1.146-153.2004 Lopez-Lopez K. Hernandez-Flores J. L. Cruz-Aguilar M. Alvarez-Morales A. 2004 In Pseudomonas syringae pv. phaseolicola, expression of the argK gene, encoding the phaseolotoxin-resistant ornithine carbamoyltransferase, is regulated indirectly by temperature and directly by a precursor resembling carbamoylphosphate Journal of Bacteriology 186 1 146 153 10.1128/JB.186.1.146-153.2004 Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., Verdier, V., Beer, S. V., & Machado, M. A. (2012). Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular Plant Pathology, 13(6), 614-629. https://doi.org/10.1111/j.1364-3703.2012.00804.x Mansfield J. Genin S. Magori S. Citovsky V. Sriariyanum M. Ronald P. Dow M. Verdier V. Beer S. V. Machado M. A. 2012 Top 10 plant pathogenic bacteria in molecular plant pathology Molecular Plant Pathology 13 6 614 629 10.1111/j.1364-3703.2012.00804.x McManus, P. S. (2014). Does a drop in the bucket make a splash? Assessing the impact of antibiotic use on plants. Current Opinion in Microbiology, 19, 76-82. https://doi.org/10.1016/j.mib.2014.05.013 McManus P. S. 2014 Does a drop in the bucket make a splash? Assessing the impact of antibiotic use on plants Current Opinion in Microbiology 19 76 82 10.1016/j.mib.2014.05.013 Melnyk, R. A., Hossain, S. S., & Haney, C. H. (2019). Convergent gain and loss of genomic islands drive lifestyle changes in plant-associatedPseudomonas. The ISME Journal, 13(6), 1575-1588. https://doi.org/10.1038/s41396-019-0372-5 Melnyk R. A. Hossain S. S. Haney C. H. 2019 Convergent gain and loss of genomic islands drive lifestyle changes in plant-associated Pseudomonas The ISME Journal 13 6 1575 1588 10.1038/s41396-019-0372-5 Mosqueda-Cano, G., & Herrera-Estrella, L. (1997). A simple and efficient PCR method for the specific detection ofPseudomonas syringaepv. phaseolicola in bean seeds. World Journal of Microbiology and Biotechnology, 13, 463-467. https://doi.org/10.1023/A:1018588503396 Mosqueda-Cano G. Herrera-Estrella L. 1997 A simple and efficient PCR method for the specific detection of Pseudomonas syringae pv. phaseolicola in bean seeds World Journal of Microbiology and Biotechnology 13 463 467 10.1023/A:1018588503396 Mosqueda, G., Van den Broeck, G., Saucedo, O., Bailey, A. M., Alvarez-Morales, A., & Herrera-Estrella, L. (1990). Isolation and characterization of the gene fromPseudomonas syringaepv. phaseolicola encoding the phaseolotoxin-insensitive ornithine carbamoyltransferase. Molecular Genetics and Genomics, 222(3), 461-466. https://doi.org/10.1007/BF00633857 Mosqueda G. Van den Broeck G. Saucedo O. Bailey A. M. Alvarez-Morales A. Herrera-Estrella L. 1990 Isolation and characterization of the gene from Pseudomonas syringae pv. phaseolicola encoding the phaseolotoxin-insensitive ornithine carbamoyltransferase Molecular Genetics and Genomics 222 3 461 466 10.1007/BF00633857 Murillo, J., Bardaji, L., & Führer, E. (2010). La grasa de las judías, causada por la bacteriaPseudomonas syringaepv. phaseolicola. Phytoma, 224, 27-32. https://www.phytoma.com/la-revista/phytohemeroteca/224-diciembre-2010/la-grasa-de-las-judias-causada-por-la-bacteria-pseudomonas-syringae-pv-phaseolicola Murillo J. Bardaji L. Führer E. 2010 La grasa de las judías, causada por la bacteria Pseudomonas syringae pv. phaseolicola Phytoma 224 27 32 Murillo, J., Bardaji, L., Navarro de la Fuente, L., Fuhrer, M. E., Aguilera, S., & Alvarez-Morales, A. (2011). Variation in conservation of the cluster for biosynthesis of the phytotoxin phaseolotoxin inPseudomonas syringaesuggests at least two events of horizontal acquisition. Research in Microbiology, 162(3), 253-261. https://doi.org/10.1016/j.resmic.2010.10.011 Murillo J. Bardaji L. Navarro de la Fuente L. Fuhrer M. E. Aguilera S. Alvarez-Morales A. 2011 Variation in conservation of the cluster for biosynthesis of the phytotoxin phaseolotoxin in Pseudomonas syringae suggests at least two events of horizontal acquisition Research in Microbiology 162 3 253 261 10.1016/j.resmic.2010.10.011 Navarrete, M. R., & Acosta-Gallegos, J. A. (2000). Resistencia del frijol al tizón de halo en el Valle de México y progreso de la enfermedad. Revista Fitotecnia Mexicana, 23, 17-28. https://doi.org/10.35196/rfm.2000.1.17 Navarrete M. R. Acosta-Gallegos J. A. 2000 Resistencia del frijol al tizón de halo en el Valle de México y progreso de la enfermedad Revista Fitotecnia Mexicana 23 17 28 10.35196/rfm.2000.1.17 Oblessuc, P. R., Bridges, D. F., & Melotto, M. (2022). Pseudomonas phaseolicolapreferentially modulates genes encoding leucine-rich repeat and malectin domains in the bean landrace G2333. Planta, 256(2), 25-52. https://doi.org/10.1007/s00425-022-03943-x Oblessuc P. R. Bridges D. F. Melotto M. 2022 Pseudomonas phaseolicola preferentially modulates genes encoding leucine-rich repeat and malectin domains in the bean landrace G2333 Planta 256 2 25 52 10.1007/s00425-022-03943-x Quiñones-Aguilar, E. E., Reyes-Tena, A., Hernández-Montiel, L. G., & Rincón-Enríquez, G. (2018). Bacteriófagos en el control biológico dePseudomonas syringaepv. phaseolicola agente causal del tizón de halo del frijol. Ecosistemas y Recursos Agropecuarios, 5(14), 191-202. https://doi.org/10.19136/era.a5n14.1159 Quiñones-Aguilar E. E. Reyes-Tena A. Hernández-Montiel L. G. Rincón-Enríquez G. 2018 Bacteriófagos en el control biológico de Pseudomonas syringae pv. phaseolicola agente causal del tizón de halo del frijol Ecosistemas y Recursos Agropecuarios 5 14 191 202 10.19136/era.a5n14.1159 Ramirez-Zapata, D., Ramos, C., Aguilera, S., Bardaji, L., Martinez-Gil, M., & Murillo, J. (2020). Two homologues of the global regulator Csr/Rsm redundantly control phaseolotoxin biosynthesis and virulence in the plant pathogenPseudomonas amygdalipv. phaseolicola 1448A. Microorganisms, 8(10), 1536-1558. https://doi.org/10.3390/microorganisms8101536 Ramirez-Zapata D. Ramos C. Aguilera S. Bardaji L. Martinez-Gil M. Murillo J. 2020 Two homologues of the global regulator Csr/Rsm redundantly control phaseolotoxin biosynthesis and virulence in the plant pathogen Pseudomonas amygdali pv. phaseolicola 1448A Microorganisms 8 10 1536 1558 10.3390/microorganisms8101536 Redondo-Salvo, S., Fernandez-Lopez, R., Ruiz, R., Vielva, L., de Toro, M., Rocha, E. P. C., Garcillan-Barcia, M. P., & de la Cruz, F. (2020). Pathways for horizontal gene transfer in bacteria revealed by a global map of their plasmids. Nature Communications, 11(1), 3602-3626. https://doi.org/10.1038/s41467-020-17278-2 Redondo-Salvo S. Fernandez-Lopez R. Ruiz R. Vielva L. de Toro M. Rocha E. P. C. Garcillan-Barcia M. P. de la Cruz F. 2020 Pathways for horizontal gene transfer in bacteria revealed by a global map of their plasmids Nature Communications 11 1 3602 3626 10.1038/s41467-020-17278-2 Reverchon, S., Meyer, S., Forquet, R., Hommais, F., Muskhelishvili, G., & Nasser, W. (2021). The nucleoid-associated protein IHF acts as a ‘transcriptional domainin’ protein coordinating the bacterial virulence traits with global transcription. Nucleic Acids Research, 49(2), 776-790. https://doi.org/10.1093/nar/gkaa1227 Reverchon S. Meyer S. Forquet R. Hommais F. Muskhelishvili G. Nasser W. 2021 The nucleoid-associated protein IHF acts as a ‘transcriptional domainin’ protein coordinating the bacterial virulence traits with global transcription Nucleic Acids Research 49 2 776 790 10.1093/nar/gkaa1227 Rico, A., Erdozáin, M., O. BA, , R. DGJ, , & Murillo, J. (2006). Detection by multiplex PCR and characterization of nontoxigenic strains ofPseudomonas syringaepv. phaseolicola from different places in Spain. Spanish Journal of Agricultural Research, 4, 261-267. https://doi.org/10.5424/sjar/2006043-203 Rico A. Erdozáin M. O. BA R. DGJ Murillo J. 2006 Detection by multiplex PCR and characterization of nontoxigenic strains of Pseudomonas syringae pv. phaseolicola from different places in Spain Spanish Journal of Agricultural Research 4 261 267 10.5424/sjar/2006043-203 Sawada, H., Kanaya, S., Tsuda, M., Suzuki, F., Azegami, K., & Saitou, N. (2002). A phylogenomic study of the OCTase genes inPseudomonas syringaepathovars: The horizontal transfer of theargK-tox cluster and the evolutionary history of OCTase genes on their genomes. Journal of Molecular Evolution, 54, 437-457. https://doi.org/10.1007/s00239-001-0055-6 Sawada H. Kanaya S. Tsuda M. Suzuki F. Azegami K. Saitou N. 2002 A phylogenomic study of the OCTase genes in Pseudomonas syringae pathovars: The horizontal transfer of the argK-tox cluster and the evolutionary history of OCTase genes on their genomes Journal of Molecular Evolution 54 437 457 10.1007/s00239-001-0055-6 Schaad, N., Cheong, S., Tamaki, S., Hatziloukas, E., & Panopoulos, N. (1995). A combined biological and enzymatic amplification (BIO-PCR) technique to detectPseudomonas syringaepv. phaseolicola in bean seed extracts. Phytopathology, 85, 243-246. https://www.apsnet.org/publications/phytopathology/backissues/Documents/1995Articles/Phyto1985n1902_1243.pdf Schaad N. Cheong S. Tamaki S. Hatziloukas E. Panopoulos N. 1995 A combined biological and enzymatic amplification (BIO-PCR) technique to detect Pseudomonas syringae pv. phaseolicola in bean seed extracts Phytopathology 85 243 246 Schaad, N. W., Azad, H., Peet, R. C., & Panopoulos, N. J. (1989). Identification ofPseudomonas syringaepv.phaseolicolaby a DNA hybridization probe. Techniques, 79(8), 903-907. https://www.apsnet.org/publications/phytopathology/backissues/Documents/1989Articles/Phyto79n08_903.PDF Schaad N. W. Azad H. Peet R. C. Panopoulos N. J. 1989 Identification of Pseudomonas syringae pv. phaseolicola by a DNA hybridization probe Techniques 79 8 903 907 Schaad, N. W., Berthier-Schaad, Y., & Knorr, D. (2007). A high throughput membrane BIO-PCR technique for ultra-sensitive detection ofPseudomonas syringaepv. phaseolicola. Plant Pathology, 56, 1-8. https://doi.org/10.1111/j.1365-3059.2006.01488.x Schaad N. W. Berthier-Schaad Y. Knorr D. 2007 A high throughput membrane BIO-PCR technique for ultra-sensitive detection of Pseudomonas syringae pv. phaseolicola Plant Pathology 56 1 8 10.1111/j.1365-3059.2006.01488.x Schwartz, H., Franc, G., Hanson, L., & Harveson, R. (2005). Disease management. In: S. HF, B. MA, H. RM, and F. GD (Eds.), Dry Bean Production and Pest Management. Colorado State Univ. pp. 109-143.. https://doi.org/https://issuu.com/scisoc/docs/43275 Schwartz H. Franc G. Hanson L. Harveson R. 2005 Disease management In: S. HF, B. MA, H. RM, and F. GD (Eds.), Dry Bean Production and Pest Management. Colorado State Univ. pp. 109-143. https://issuu.com/scisoc/docs/43275 Sikdar, R., & Elias, M. (2020). Quorum quenching enzymes and their effects on virulence, biofilm, and microbiomes: a review of recent advances. Expert Review of Anti-Infective Therapy, 18(12), 1221-1233. https://doi.org/10.1080/14787210.2020.1794815 Sikdar R. Elias M. 2020 Quorum quenching enzymes and their effects on virulence, biofilm, and microbiomes: a review of recent advances Expert Review of Anti-Infective Therapy 18 12 1221 1233 10.1080/14787210.2020.1794815 Sultan, M., Arya, R., & Kim, K. K. (2021). Roles of two-component systems inPseudomonas aeruginosavirulence. International Journal of Molecular Sciences, 22(22), 12152-12172. https://doi.org/10.3390/ijms222212152 Sultan M. Arya R. Kim K. K. 2021 Roles of two-component systems in Pseudomonas aeruginosa virulence International Journal of Molecular Sciences 22 22 12152 12172 10.3390/ijms222212152 Sundin, G. W., & Wang, N. (2018). Antibiotic resistance in plant-pathogenic bacteria. Annual Review of Phytopathology, 56, 161-180. https://doi.org/10.1146/annurev-phyto-080417-045946 Sundin G. W. Wang N. 2018 Antibiotic resistance in plant-pathogenic bacteria Annual Review of Phytopathology 56 161 180 10.1146/annurev-phyto-080417-045946 Sundin, G. W., Wang, N., Charkowski, A. O., Castiblanco, L. F., Jia, H., & Zhao, Y. (2016). Perspectives on the transition from bacterial phytopathogen genomics studies to applications enhancing disease management: from promise to practice. Phytopathology, 106(10), 1071-1082. https://doi.org/10.1094/Phyto-03-16-0117-FI Sundin G. W. Wang N. Charkowski A. O. Castiblanco L. F. Jia H. Zhao Y. 2016 Perspectives on the transition from bacterial phytopathogen genomics studies to applications enhancing disease management: from promise to practice Phytopathology 106 10 1071 1082 10.1094/Phyto-03-16-0117-FI Tamura, K., Imamura, M., Yoneyama, K., Kohno, Y., Takikawa, Y., Yamaguchi, I., & Takahashi, H. (2002). Role of phaseolotoxin production byPseudomonas syringaepv. actinidiae in the formation of halo lesions of kiwifruit canker disease. Physiology and Molecular Plant Pathology, 60, 207-214. https://doi.org/10.1006/pmpp.2002.0405 Tamura K. Imamura M. Yoneyama K. Kohno Y. Takikawa Y. Yamaguchi I. Takahashi H. 2002 Role of phaseolotoxin production by Pseudomonas syringae pv. actinidiae in the formation of halo lesions of kiwifruit canker disease Physiology and Molecular Plant Pathology 60 207 214 10.1006/pmpp.2002.0405 Taylor, J. D., & Dudley, C. L. (2008). Seed treatment for the control of halo‐blight of beans (Pseudomonas phaseolicola). Annals of Applied Biology, 85, 223-232. https://doi.org/10.1111/j.1744-7348.1977.tb01796.x Taylor J. D. Dudley C. L. 2008 Seed treatment for the control of halo‐blight of beans (Pseudomonas phaseolicola) Annals of Applied Biology 85 223 232 10.1111/j.1744-7348.1977.tb01796.x Thomas, W. J. W., Amas, J. C., Dolatabadian, A., Huang, S., Zhang, F., Zandberg, J. D., Neik, T. X., Edwards, D., & Batley, J. (2024). Recent advances in the improvement of genetic resistance against disease in vegetable crops. Plant Physiology, 196(1), 32-46. https://doi.org/10.1093/plphys/kiae302 Thomas W. J. W. Amas J. C. Dolatabadian A. Huang S. Zhang F. Zandberg J. D. Neik T. X. Edwards D. Batley J. 2024 Recent advances in the improvement of genetic resistance against disease in vegetable crops Plant Physiology 196 1 32 46 10.1093/plphys/kiae302 Tock, A. J., Fourie, D., Walley, P. G., Holub, E. B., Soler, A., Cichy, K. A., Pastor-Corrales, M. A., Song, Q., Porch, T. G., Hart, J. P., Vasconcellos, R. C. C., Vicente, J. G., Barker, G. C., & Miklas, P. N. (2017). Genome-wide linkage and association mapping of halo blight resistance in common bean to race 6 of the globally important bacterial pathogen. Frontiers in Plant Science, 8, 1170-1195. https://doi.org/10.3389/fpls.2017.01170 Tock A. J. Fourie D. Walley P. G. Holub E. B. Soler A. Cichy K. A. Pastor-Corrales M. A. Song Q. Porch T. G. Hart J. P. Vasconcellos R. C. C. Vicente J. G. Barker G. C. Miklas P. N. 2017 Genome-wide linkage and association mapping of halo blight resistance in common bean to race 6 of the globally important bacterial pathogen Frontiers in Plant Science 8 1170 1195 10.3389/fpls.2017.01170 Tourte, C., & Manceau, C. (1995). A strain ofPseudomonas syringaewhich does not belong to pathovar phaseolicola produces phaseolotoxin. European Journal of Plant Pathology, 101, 483-490. https://doi.org/10.1007/BF01874471 Tourte C. Manceau C. 1995 A strain of Pseudomonas syringae which does not belong to pathovar phaseolicola produces phaseolotoxin European Journal of Plant Pathology 101 483 490 10.1007/BF01874471 Wyatt, G. M., Turner, J. G., & Morgan, M. R. A. (1989). Rapid and specific detection ofPseudomonas syringaepv. phaseolicola by immunological methods. Food and Agricultural Immunology, 1, 53-63. Wyatt G. M. Turner J. G. Morgan M. R. A. 1989 Rapid and specific detection of Pseudomonas syringae pv. phaseolicola by immunological methods Food and Agricultural Immunology 1 53 63 Xin, X. F., Kvitko, B., & He, S. Y. (2018). Pseudomonas syringae: what it takes to be a pathogen. Nature Reviews Microbiology, 16(5), 316-328. https://doi.org/10.1038/nrmicro.2018.17 Xin X. F. Kvitko B. He S. Y. 2018 Pseudomonas syringae: what it takes to be a pathogen Nature Reviews Microbiology 16 5 316 328 10.1038/nrmicro.2018.17 Zhang, Y. X., & Patil, S. S. (1997). ThephtElocus in the phaseolotoxin gene cluster has ORFs with homologies to genes encoding amino acid transferases, the AraC family of transcriptional factors, and fatty acid desaturases. Molecular Plant-Microbe Interactions, 10(8), 947-960. https://doi.org/10.1094/MPMI.1997.10.8.947 Zhang Y. X. Patil S. S. 1997 The phtE locus in the phaseolotoxin gene cluster has ORFs with homologies to genes encoding amino acid transferases, the AraC family of transcriptional factors, and fatty acid desaturases Molecular Plant-Microbe Interactions 10 8 947 960 10.1094/MPMI.1997.10.8.947 Review Article Molecular aspects of phaseolotoxin biosynthesis produced by Pseudomonas syringae pv. phaseolicola <italic>ABSTRACT</italic>

Background/Objective.

Phaseolotoxin is produced by one of the most important and studied phytopathogens in the agricultural area: Pseudomonas syringae pv. phaseolicola. This bacterium causes halo blight, a disease that devastates the bean crop. The success of P. syringae pv. phaseolicola is related to its genetic information, which allows it to synthesize deleterious metabolites for its host, such as phaseolotoxin. This research aimed to analyze the molecular basis of the mechanism of action, immunity, genetics involved in the biosynthesis of phaseolotoxin, molecular diagnostic strategies, and molecular techniques developed in Mexico to manage bean halo blight.

 Materials and Methods.

The search and analysis of the most relevant scientific information regarding the biosynthesis of phaseolotoxin and the molecular studies of the pathogenicity and virulence factors of P. syringae pv. phaseolicola has contributed to the development of molecular strategies focused on the diagnosis and management of halo blight in beans.

 Results.

P. syringae pv. phaseolicola produces phaseolotoxin, responsible for forming the chlorotic halo characteristic of halo blight, this toxin is an inhibitor of OCTase, an enzyme that participates in the arginine synthesis pathway in beans. The Pht and Pbo chromosomal regions contain genes involved in the synthesis and immunity of phaseolotoxin, and the expression of these genes is regulated by the GacS/GacA system and temperature. The identification of genes involved in the synthesis of pathogenicity and virulence factors, such as phaseolotoxin, has allowed the development of strategies for diagnosis and management of the disease based on DNA amplification and the use of molecular markers that facilitate the identification of bean cultivars resistant to the pathogen.

 Conclusion.

Molecular studies have contributed to understanding how the phaseolicola pathovar produces phaseolotoxin. This information has been essential to understanding how bacteria have evolved from non-pathogenic to pathogenic variants. In addition, they provide information that allows the development of new strategies for timely diagnosis and contributes to strategies for managing halo blight.

 Keywords: Pathogenicity Virulence Phytotoxins Horizontal Transference Genetic Regulation. Introduction

The common bean (Phaseolus vulgaris) is a highly important food and commercial crop worldwide. This crop is widely adapted to environments with moderate growth temperatures and its popularity is due to it being easy to produce (Foyer et al., 2016). The quality, yield and production of this crop is currently affected by numerous phytosanitary problems, some of which are created by diverse microorganisms that limit the quality of agricultural products and are responsible for enormous economic losses, in addition to being a significant threat for the world’s food security (Sundin et al., 2016). Among these microorganisms is Pseudomonas syringae, one of the most important pathogens for this crop and others such as tomato, kiwifruit, tobacco, lime, oat, wheat, soybean, cucumber, rice and others (Chen et al., 2022). The P. syringae species includes 62 pathovars, depending on the host they infect, including most of the phytopathogens of the Pseudomonas genus (Bull et al., 2010). The success of a phytopathogen to infect, colonize and induce a series of symptoms in its host is directly related to its genetic information. This information, represented by the genes, helps it synthesize and secrete metabolites that are deleterious to the plant (Lamichhane et al., 2015). The diverse P. syringae pathovars are known for producing a wide spectrum of metabolites that act as pathogenicity and virulence factors; among these are phytotoxins, which directly damage the plant cells and influence the development of the disease. P. syringae pv. phaseolicola is the causal agent of the halo blight disease in bean, which can be devastating, particularly when adverse weather conditions persist. The presence of a chlorotic halo that characterizes this disease is precisely caused by phaseolotoxin, a phytotoxin produced by P. syringae pv. phaseolicola (Arrebola et al., 2011). The genetics related to the synthesis of phytotoxins has become remarkably important, since the genes coding for the enzymes involved in the assembly, maturation and even those required for secretion are clustered in chromosomal fragments known as genomic islands. These islands contain all the elements needed to be transferred horizontally between the different pathovars. These genetic transfer mechanisms are highly relevant because the bacteria acquire new pathogenic abilities (Melnyk et al., 2019). Advances in the genetic study of pathogenicity and virulence factors, such as phytotoxins, favor the understanding of how pathogens acquire and produce the molecular arsenal needed for the development of diseases in plant systems (Ichinose et al., 2013).

Considering that every P. syringae pathovar produces a diversity of phytotoxins, this revision will focus on the analysis of one of those cases: the genetic involved in the biosynthesis of the phaseolotoxin produced by the phaseolicola pathovar and its involvement in the development of the halo blight in bean. This information essentially contributes to the understanding of how this phytopathogenic bacterium has acquired genes needed to synthesize phaseolotoxin and how it has coordinated its endogenous regulation system for this purpose. In addition, the potential of this type of genetic studies on the development of strategies for the diagnosis and timely management of diseases is analyzed.

<italic>P. syringae pv. phaseolicola</italic>

Halo blight is one of the main diseases that affects the bean crop and it is caused by the bacterium P. syringae pv. phaseolicola. This bacterium persists in the seed and activates after the seed germination; it can survive as a parasite in the plant tissue and as an epiphyte on the surface of leaves. The bacterium has been observed in most bean-producing regions of the world and it has become a highly destructive phytopathogen for this crop, causing losses that range between 50 and 100% of the production (Arnold et al., 2011; Lépiz-Ildefonso et al., 2015). The bacterium can be found in the different phenological stages affecting leaves, stem, pods and seeds. In leaves, small, aqueous lesions appear which later become necrotic; approximately one week after infection, one or more lesions become surrounded by a necrotic halo (Figure 1 A and B). Pods also develop reddish-brown, aqueous and sunken lesions (Figure 1 C and D). Infections in pods can be transferred to seeds, causing them to shrink, discolor or become smaller than normal. The bacterium develops in a range of 28-30 °C with a relative humidity higher of over 80%, although more severe symptoms appear at temperatures ranging between 18 and 20 ºC. A reduction in temperature induces the production of phaseolotoxin, which is responsible for the formation of the chlorotic halo and the characteristic yellowing observed during the development of the disease (Arnold et al., 2011; Xin et al., 2018).

Symptoms produced by <italic>P. syringae</italic> pv. <italic>phaseolicola</italic> on bean. A y B, Symptoms on leaves. C y D, Symptoms on pods. Source: Adapted from Schwartz, (2008); Harveson, (2009).

<italic>Phaseolotoxin and its action mechanism</italic>

From a chemical point of view, the structure of phaseolotoxin is unusual and has two different components: an inorganic residue, Nδ- (N’-Sulphodiaminophosphinyl) and a tripeptide, L-ornithyl-alanyl-homoarginine (Figure 2) (Arrebola et al., 2011). This toxin acts as a reversible inhibitor of the enzyme ornithine carbamoyltransferase (OCTase EC 2.1.3.3.), codified by the gene argF. OCTase catalyzes the conversion of ornithine and carbamoylphosphate into citrulline in the arginine synthesis pathway. In the plant cell, phaseolotoxin is hydrolyzed due to the action of peptides to produce Nδ-(N´-sulphodiaminophosphynil)-L-ornithine (called octicidin or PSOrn), which is an irreversible inhibitor of OCTase and the predominant form in which the toxin is found in infected bean plants (Sawada et al., 2002). This inhibition causes an accumulation of ornithine and an arginine deficiency. As the toxin spreads through the foliar tissue, it alters the synthesis of the chlorophyll, causing chlorosis and growth inhibition in plant tissues, finally leading to the death of host cells. In addition, the systemic invasion of the plant is facilitated by the

Phaseolotoxin structure and PSOrn, product of phaseolotoxin degradation by plant peptidases.

effect of the phaseolotoxin, thus contributing significantly to the virulence of the

pathogen (Arnold et al., 2011).

Originally, phaseolotoxin was considered to be restricted to P. syringae pv. phaseolicola, although it is also produced by the pathovar actinidiae, which infects kiwifruit (Actinidia chinensis) (Fujikawa and Sawada, 2019), and by a strain of the pathovar syringae, isolated from Vicia sativa (Tourte and Manceau, 1995). Several isolates belonging to the pathovar phaseolicola synthesize phaseolotoxin when grown at 18-20 °C, although its degree of production may vary between isolates. On the other hand, strains have been identified that belong to the pathovar phaseolicola, which are unable to produce it, since they lack all or part of the genes required for their synthesis (Gonzalez et al., 2003).

 <italic>Immunity to phaseolotoxin</italic>

Initially, determining how P. syringae pv. phaseolicola was immune to its own toxin was a mystery. The toxic effect of phaseolotoxin was evident, since it does not only inhibit OCTase from the bean, but also a large variety of plant and bacterial OCTases, and even from mammals (Bender et al., 1999). In these organisms, it causes an auxotrophy phenotype to arginine, which is alleviated by adding arginine or citrulline to the growth medium. By contrast, P. syringae pv. phaseolicola strains that produce phaseolotoxin are insensitive to its toxin and do not require arginine or citrulline supplements. Everything was clarified when the gene argK, which codifies for a phaseolotoxin-resistant OCTase, was identified and characterized (Mosqueda et al., 1990). Thus, P. syringae pv. phaseolicola was observed to present two OCTase activities; one activity that is sensitive to the toxin produced at 28 °C and the activity of the resistant OCTase, which guarantees the optimum

supply of arginine required for bacterial growth, under conditions of phaseolotoxin synthesis (Lopez-Lopez et al., 2004). The knowledge on the bacterial resistance to the effect of its toxins has been used in several strategies to develop resistant plants. In the case of phaseolotoxin, argK has been used as transgene in tobacco plants (Nicotiana tabacum) and has been successful in developing plants that are resistant to the effect of phaseolotoxin (De la Fuente-Martinez et al., 1992). Studies such as these can be extrapolated to other crops of agronomic interest, allowing for the generation of cultivars that are resistant to the attack of pathogens.

 <italic>The genetics behind the phaseolotoxin biosynthesis</italic>

Diverse studies have focused on the chemistry of phaseolotoxin, its form of action and its contribution to pathogenicity, although little is known about its biosynthesis. Through genetic analyses, relevant information has been provided to elucidate how this toxin is synthesized. The first insight into the genes involved in its synthesis was the identification and characterization of amtA and desI, which codify for an aminotransferase and one desaturase of fatty acids, respectively (Hernandez- Guzman and Alvarez-Morales, 2001; Zhang and Patil, 1997). We currently have the description and analysis of a 30,245 pb region of the chromosome of P. syringae pv. phaseolicola NPS3121, called the Pht Region (Figure 3A), which contains 23 genes required for the synthesis of phaseolotoxin, including the genes argK, amtA and desI (Aguilera et al., 2007). The Pht Region is delimited by insertion sequences and transposases, suggesting that this fragment constitutes a genomic island that could have been acquired through horizontal transfer events (Murillo et al., 2011). The precise function of the codified genes in the Pht Region remains uncertain and some of these genes have been studied further (Aguilera et al., 2012; Arai y Kino, 2008; Chen et al., 2015; Gonzalez-Villanueva et al., 2014). Thus, it has been possible to assign a function to them in the phaseolotoxin synthesis and regulation process (Table 1).

Phaseolotoxin is composed of a tripeptide and its synthesis has been proposed to

be via a mechanism called a non-ribosomal peptide synthesis. Enzyme complexes such as Non-Ribosomal Peptide Synthases (NRPS) and/or Polyketide Synthases (PKS) participate in this process. The gene PSPPH_4550, identified as an NRPS, participates in the phaseolotoxin synthesis (De la Torre-Zavala et al., 2011). Interestingly, the gene PSPPH_4550 is codified outside of the Pht region and is part of another genomic island called the Pbo Region. This fragment contains 16 genes (Figure 3B) some of which codify for NRPS or PKS (Table 2), suggesting its participation in the synthesis of the tripeptide (Guardado-Valdivia et al., 2021). To date, multiple genes involved in the phaseolotoxin synthesis have been identified (Table 1 and 2), and functions have been assigned to some of them.

Graphic representation of the Pht and Pbo Regions on <italic>P. syringae</italic> pv. <italic>phaseolicola</italic> chromosome. A, Pht Region operons. B, Pbo Region operons. Each arrow represents one gene, the direction of the arrow indicates the direction of transcription.

Function of <italic>pht</italic> genes involved in phaseolotoxin synthesis.
Gene Protein coded Function Reference
argK Ornithine carbamoyltransferase Catalyze the reaction between carbamoyl phosphate and ornithine to form citrulline under phaseolotoxin synthesis conditions. Lopez-Lopez et al., 2004
amtA Amidinotransferase Catalyze the reversible transfer reaction of amidino groups to synthesize L-homoarginine. Hernandez-Guzman y Alvarez-Morales, 2001
desI Fatty acid desaturase Dehydrogenate fatty acids, creating double bonds between carbon-carbon; temperature perception. Zhang y Patil, 1997
phtU L-aminoacid ligase Catalyze the condensation of amino acids. Arai y Kino, 2008
phtQ Peptide ligase Catalyze the formation of peptide bonds. Chen et al., 2015
phtL Pyruvate phosphate dikinase Transfer phosphate groups from pyrophosphate and phosphoenolpyruvate to an AMP molecule to synthesize ATP, phosphate, and pyruvate. Gonzalez-Villanueva et al., 2014
phtA Nucleoside triphosphate hydrolase Hydrolyze the beta-gamma phosphate bond of a nucleoside triphosphate. Aguilera et al., 2012

Prediction of the function of <italic>pbo</italic> genes involved in the phaseolotoxin synthesis.
Gene Protein coded Function Reference
pboO Synthetase c Form amide bonds in the synthesis process of non-ribosomal peptides. Guardado-Valdivia et al., 2021
pboM Ketoacyl transferase Catalyze the elongations of fatty acids in the synthesis of polyketides. Guardado-Valdivia et al., 2021
pboA AMP-binding enzym Condense and adenylate in the process of synthesis of non-ribosomal peptides. De la Torre-Zavala et al., 2011
pboB Ketoacyl synthase Catalyze the decarboxylating Claisen condensation of fatty acids in the synthesis of polyketides. Guardado-Valdivia et al., 2021
pboC Phosphopantheine binding domain Bind amino acids and activated fatty acids in the synthesis of non-ribosomal peptides. Guardado-Valdivia et al., 2021

However, there is still much work to be done to elucidate the functions of the rest of the genes, and particularly, those genes involved in the synthesis of the inorganic compound of the toxin.

 <italic>Regulation of the phaseolotoxin synthesis</italic>

It is evident that the phytopathogens require genetic mechanisms that give them the ability to adapt in response to their conditions. In phytopathogenic bacteria, the regulation systems of two components allow for the adaptation to different conditions in response to the environmental signals, transferring the signal to transcription factors, which activate the gene expression (Sultan et al., 2021). P. syringae pv. phaseolicola has several two-component systems, although the GacS/ GacA system is of great importance due to its role in the control of virulence and pathogenicity determinants, ecological adaptation, Quorum sensing (Qs) systems, and the synthesis of diverse secondary metabolites (Latour, 2020). The GacS/ GacA system controls all genes involved in the synthesis and regulation of the phaseolotoxin in P. syringae pv. phaseolicola NPS3121 known to date (De la Torre- Zavala et al., 2011; Ramirez-Zapata et al., 2020). Other global regulators, such as the IHF transcriptional factor, also participates in this process. The function of IHF as a regulator of the expression of virulence factors has been widely reported (Arvizu-Gomez et al., 2011; Reverchon et al., 2021). These findings reveal that some genes acquired through horizontal transfer events can be integrated into the preexisting global regulation systems (Redondo-Salvo et al., 2020). In this sense, the genes involved in the biosynthesis of phaseolotoxin were not the exception.

For P. syringae pv. phaseolicola NPS3121, the descent in temperature is also a determining factor in the production of phaseolotoxin. This change controls the transcription of the pht and pbo genes (Aguilera et al., 2007; Guardado-Valdivia et al., 2021). The information gathered so far allows to propose a signaling and regulatory method for the biosynthesis of phaseolotoxin in P. syringae pv. phaseolicola NPS3121 (Figure 4). This model schematically represents the stimulus and signaling cascade responsible for triggering the synthesis of phaseolotoxin.

Model of signaling and regulation of phaseolotoxin biosynthesis in <italic>P. syringae</italic> pv. <italic>phaseolicola</italic> NPS3121. Temperature is sensed by the GacS membrane sensor, which autophosphorylates therefore (1). Phosphorylated GacS transfers phosphate to the response regulator GacA (2). GacA controls the expression of <italic>pht</italic> genes, mediated by the IHF regulator. GacA also controls the transcription of the <italic>pbo</italic> genes (3). Finally, phaseolotoxin is synthesized, which inhibits bean OCTase and prevents the synthesis of arginine. Consequently, the chlorotic halo develops.

<italic>Transfer of the Pht and Pbo Regions between pathovars</italic>

In bacteria, the horizontal transfer of genes through accessory genetic elements such as plasmids, transposons, prophages or genomic islands helps them acquire and express genes from a wide range of species (Carraro et al., 2017). The Pht region has been suggested to constitute a genomic island that P. syringae acquired using horizontal transfer mechanisms. This has been supported by the similarity of the organization and the sequence of the different versions of the Pht region identified in the pathovars phaseolicola and actinidae, which clearly denote a common origin and a preserved functionality (Murillo et al., 2011). Additionally, finding

P. syringae pv. phaseolicola strains lacking the Pht region has also supported this proposal (Gonzalez et al., 2003). The Pbo Region also comprises another genomic island. Despite both islands participating in the synthesis of phaseolotoxin, there is no correlation between the possession of the Pbo Region and the Pht Region, suggesting that its acquisition was carried out independently, and once acquired, they were incorporated into the chromosome of P. syringae pv. phaseolicola, remaining under the control of the preexisting global regulation systems (De la Torre-Zavala et al., 2011; Guardado-Valdivia et al., 2021). Pathogenic bacteria have evolved from related non-pathogenic organisms, due to the acquisition of genetic material that codifies for multiple pathogenicity and virulence factors. In regards to the P. syringae pathovars, it is important to understand how the genetic mobility mechanisms have contributed to their pathogenicity and virulence, because, in the end, this is what has turned this species into one of the 10 most important phytopathogenic bacteria in the world (Mansfield et al., 2012). In terms of the pathovar phaseolicola, studies on the molecular genetics of its interaction with bean and the evolution of its pathogenicity and virulence have contributed with important discoveries to the field of the plant-microorganism interactions, leading P. syringae pv. phaseolicola to be considered a model for the study of plant-pathogen molecular interaction (Arnold et al., 2011).

<italic>Pseudomonas syringae pv. phaseolicola molecular detection strategies</italic>

One of the most important requirements to manage plant diseases is the timely identification of the causal agent. There are currently biotechnological techniques that accelerate the achievement of results and have enabled the timely identification of phytopathogenic bacteria. Additionally, they have complemented traditional diagnostic processes such as visual examination, pathogen culturing, microscopy and pathogenicity tests.

In terms of the detection and identification of P. syringae pv. phaseolicola, diverse molecular strategies have been developed in order to carry out an accurate and timely detection. Within the first strategies reported is the Enzyme-Linked Immunosorbent Assay (ELISA). The antisera obtained specifically recognized the phaseolicola pathovar, without showing a cross-reaction with other P. syringae pathovars (Wyatt et al., 1989). Around the same time, a strategy was developed based on the hybridization of DNA probes carrying genes involved in the synthesis of phaseolotoxin. This technique helped detect and identify the pathovar phaseolicola from seeds and macerated samples of tissue with lesions (Schaad et al., 1989).

With the development of the Polymerase Chain Reaction (PCR), strategies were implemented to detect and identify multiple phytopathogens and P. syringae pv. phaseolicola was not an exception. Specific oligonucleotides were designed for

this purpose from the available genes involved in the biosynthesis of phaseolotoxin (Mosqueda-Cano and Herrera-Estrella, 1997; Schaad et al., 1995; Schaad et al., 2007). Table 3 describes some of the oligonucleotides used for the identification and the regions they amplify.

Oligonucleotides used to identify strains of <italic>P. syringae</italic> pv. <italic>phaseolicola</italic> producing phaseolotoxin.
Name Sequence Target Reference
BRL519 BRL520 TTCATTCAAACCTCGCCCGTGTG TGAAAGGAGCCGCCGAAACTATTG amtA Aguilera et al., 2007
PA5.1 PA3.1 AGCTTCTCCTCAAAACACCTGC TGTTCGCCAGAGGCAGTCATG desI Schaad et al., 1995
62a 63a CAATGAAGATTACAAGCCTG GCTAGCTATCAGGGGACGAC argK Mosqueda-Cano y Herrera-Estrella, 1997
P3004L P3004R CTGTCTGGCAGCCACTACAAAG GGCTGCAAATTGTGGGATTT Tox-Region Rico et al., 2006
AVR1-F AVR1-R CCGCCGTAGCAGGGCTTCAC GGACCAATCTCTTTTCTCAA phtL Gonzalez et al., 2003
PHTE-F PHTE-R AATATAGGCTTCAACTTCCTC CCAGGTCAACTCACTTCCG phtE Gonzalez et al., 2003
P25156 Ptx1I5c GCAAAAACGAAAACACCAGGCT ATCGCGCTGATCCGGAAAGG phtA Aguilera et al., 2017
P12556 P11311 TCCGGTTATCGCTTCAGGTCG GCAGTTTCTGATCTTGGGCCC phtM-N Aguilera et al., 2017

It is important to consider the existence of P. syringae pv. phaseolicola isolates that do not produce phaseolotoxin and therefore cannot be detected using these oligonucleotides (Rico et al., 2006). Additionally, the production of phaseolotoxin is not only a characteristic of the pathovar phaseolicola, so these assays could also detect other pathovars (Tamura et al., 2002). According to this, new methodologies have been designed, such as the TaqMan real-time PCR, in which specific oligonucleotides based on the site-specific recombinase gene were used. With this strategy, we were able to differentiate between phaseolotoxin producing and non- producing P. syringae pv. phaseolicola strains (Cho et al., 2010). Another DNA amplification technique, known as a Loop-Mediated Isothermal Amplification (LAMP), has been adapted to facilitate the characterization and quick and specific identification of the pathovar phaseolicola (Li et al., 2009). The molecular diagnosis of P. syringae pv. phaseolicola is crucial for the efficient management of halo

blight in bean crops. Although the molecular diagnosis can be more expensive and require specialized infrastructure, its high precision, speed and capacity to detect infections in an early and quantitative way make it a crucial tool in the fight against this pathogen. In time, molecular diagnosis techniques are expected to continue improving and become more accessible, which will allow for a more efficient management of bacterial diseases in agriculture.

 <italic>Molecular strategies to manage halo blight in bean. An alternative for agriculture in Mexico</italic>

In Mexico, the management of halo blight in bean has become a challenge for farmers, due to the aggressive nature of the disease and its ability to spread quickly (Félix-Gastélum et al., 2016). P. syringae pv. phaseolicola is widely distributed in the country (Figure 5), and is therefore a risk for the country’s bean production (Félix-Gastélum et al., 2016; Jiménez-Hernández et al., 2023; Navarrete and Acosta-Gallegos, 2000; Quiñones-Aguilar et al., 2018). For this reason, for the management of halo blight, strategies have been developed such as the application of agricultural antibiotics, the elimination of harvest residues, crop rotation or the use of resistant bean varieties, and others (Schwartz et al., 2005). By combining these measures, it has been possible to control the development of the disease, although it has not been enough.

Representative map of the distribution of <italic>P. syringae</italic> pv. <italic>phaseolicola</italic> in Mexico. The states marked with yellow color indicate the presence of this bacteria.

Based on advances in biotechnology, molecular strategies have emerged as a powerful tool that can complement conventional strategies and achieve a more efficient and sustainable management of pathogens. Genetic resistance is one of the most effective strategies to control plant diseases. In Mexico, the use of molecular markers has favored the identification of bean varieties, such as Flor de Mayo M38, San Rafael, Pinto Laguna 80 and Pinto Saltillo, which are resistant to P. syringae pv. phaseolicola (Jiménez-Hernández et al., 2023). Despite this, resistance in the commercial varieties available in Mexico continues to be limited, therefore the development of new resistant varieties with novel molecular techniques such as CRISPR/Cas9 genetic editing (Thomas et al., 2024) may be an alternative to specifically introduce genetic resistance in the bean varieties. In addition, technologies based on the so-called “omic sciences” offer valuable information to understand the interaction of P. syringae pv. phaseolicola with the bean. Proteomic analyses of the halo blight-resistant bean varieties provide information to understand the nature of this resistance (Cooper et al., 2020; Oblessuc et al., 2022), as well as generating information that could be used to develop control strategies based on the analysis of genetic and protein markers of these varieties. The use of bacteriophages in biological control is also a promising and eco-friendly alternative for the management of pathogenic bacteria. In 2018, Quiñones-Aguilar et al. isolated native bacteriophages native to the state of Zacatecas and evaluated their lytic activity against virulent strains of P. syringae pv. phaseolicola. In this way, they identified a bacteriophage capable of reducing the damage caused by the phaseolicola pathovar in green beans by up to 60% (Quiñones-Aguilar et al., 2018). In Mexico, molecular techniques focused on managing halo blight and other crop diseases are limited, making it necessary to promote the development of new strategies to complement the management of halo blight in bean crops in Mexican agriculture.

 Conclusions

Pseudomonas syringae pv. phaseolicola is a bacterial species with a great pathogenic ability, and has therefore become a study model for the understanding of the plant-pathogen molecular interaction. The regions Pht and Pbo, which contain genes involved in the biosynthesis of phaseolotoxin, play a key role in the development of halo blight. Evidence shows that the acquisition of the Pht and Pbo regions was carried out via horizontal transfer events, a common activity among phytopathogens. Thus, they acquire foreign genetic material and control it through its endogenous regulation system, which, in the case of the genes pht and pbo, were incorporated into the global regulation systems of the components, GacS/

GacA and of the regulator IHF. For P. syringae pv. phaseolicola, acquiring the Pht and Pbo regions has been a favorable event, since it helped it increase its degree of virulence in such a way that the result of this new ability is to devastate the bean crop with greater efficiency. Molecular studies of the pathogenicity and virulence factors of P. syringae pv. phaseolicola, such as in the case of phaseolotoxin, offers valuable information for the design of diagnostic strategies and the management of the halo blight. The development of new molecular strategies will favor the early diagnosis, the identification of new pathogenic strains and the development of resistant crops, which will, in turn, reduce the economic impact of diseases in agronomically important crops such as the bean.