Bananas and plantains (Musa spp.) are the fourth most important crop in the world, surpassed only by rice, wheat, and corn (FAOSTAT, 2024). This fruit is available throughout the year and is grown in 135 countries in the tropical and subtropical regions. Although banana represents a significant source of income in the Latin American region, only 15% of the production is exported as a commodity since most harvest is in small farms or backyards, for domestic consumption or local markets (FAOSTAT, 2024).

Bananas and plantains are affected by several pathogens worldwide, however, Fusarium wilt, which is caused by a complex of isolates of the fungus Fusarium oxysporum (Fo). The specific complex of F. oxysporum f. sp. cubense (Foc), constituted for at least four races, is considered the most destructive diseases for this crop (van Westerhoven et al., 2022). Foc produces three types of asexual spores: macroconidia, microconidia, and chlamydospores, which have roles in dispersal, reproduction, and survival (Pegg et al., 2019). Once Foc invades a plantation, it is hard to control, because the pathogen persists in the soil for long periods (Maryani et al., 2019). Thus, the most effective alternative to control the disease is the replacement of susceptible cultivars with others resistant to the pathogen.

In the past, nearly all commercial plantations in the world changed their susceptible varieties by Cavendish subgroup genotypes (Genome AAA). The recent emergence of Foc Tropical race 4 (Foc R4T in Spanish), which is capable to infect members of the Cavendish subgroup, has become the main threat to the banana and plantains industry. This is more problematic because currently, the markets demand primarily fruits of the ‘Giant Naine’ clone from the Cavendish subgroup (Genome AAA), and there are no other resistant banana genotypes available (Ordoñez, 2018). In México, nearly forty thousand hectares of ‘Gros Michel’ cultivar was devastated in the mid-1950s due to Foc race 1, forcing its replacement by resistant clones of the ʻCavendishʼ subgroup, such as ʻGrand Naineʼ. For example, a decade ago, the state of Nayarit had 3,000 ha of ʻSilkʼ and 3,500 ha of ʻGros Michelʼ cultivars. Recently, banana and plantain production in México has been concentrated in 16 states, with Chiapas, Tabasco, Colima, and Veracruz state being the main producers, accounting for 72.5% of the planted area, 75.3% of the volume produced, and 66.3% of the value of the crop’s production. The volume obtained in 2023 was 2,642,338 tons, 1.9% higher than the previous year’s production (SIAP, 2024).

Knowledge of the genetic diversity of populations of phytopathogenic fungi and their mode of reproduction is relevant for crop management programs, and to reduce the impact of the disease (McDonald and Linde, 2002). In the case of Foc, it has a relatively diverse genetic structure for an asexual reproductive fungus (Martínez-de la Parte et al., 2024). The genetic information of the pathogen can be used to design effective management practices for the disease, as well as for breeding programs to develop a resistant or tolerant banana cultivar, and for quarantine purposes in a particular country or geographical location (Magdama et al., 2020; van Westerhoven et al., 2022; Chittarath et al., 2022; Baruah et al., 2025). In México, despite the sustained increase in the number of plantations of banana and plantain, information regarding the diversity and genetic structure of Foc is scarce. This reserach present the first analysis that studies Fo isolates from different regions using SSR markers as a preliminary approximation to justify deep Foc diversity studies.

Sampling was conducted directly on Musa plants from ‘Pisang Awak’ (ABB), ‘Silk’ (AAB), and ‘Bluggoe’ (ABB) varieties, affected by Fusarium wilt in five banana-producing areas of México: Colima, Michoacán, Jalisco, Nayarit, and Yucatán states. (Table 1). In each sampled plantation, we gather pseudostems of six- to eight-month-old wilting symptomatic plants. Discolored vascular strands were cut into 2-4 pieces and stored in a paper bag. In the laboratory, it was obtained single-spore cultures using the protocol proposed by Mostert et al. (2017). The morphology and cultural characteristics of Foc isolates were determined as described by Leslie and Summerell (2006). The isolates were stored in sterile glycerol 15% (v/v) at -80 °C. Further testing to verify the isolate identity to F. oxysporum f. sp. cubense was not conducted. For genomic DNA extraction of 96 monosporic Foc cultures, we followed the protocol of Möller and Bahnweg (1992). We analyzed six SSR loci for haplotypes characterization. The primers used are listed in Table 2. Because these SSR were suggested to study the structure of F. oxysporum (Fo) (Bogale et al., 2005), it is assumed that this work targeted isolates of Fo as well as those belonging to Foc races but race 4 (Foc R4T), which is officially not reported in Mexico. PCR cycles were done as specified by Bogale et al. (2005). The PCR products were analyzed by electrophoresis in 1.5% agarose gel and then stained in ethidium bromide solution and documented in a ChemiBis MF-2 system (Bio-Imaging Systems, Neve Yamin, Israel). A binary matrix for the six loci and a total of 96 isolates was constructed.

Table 1

Isolate	County	State	Cultivar	Geographic location	Altitude (msnm)
ACM1			Silk (AAB)	18°53´23”N, 104° 0´ 0” O	11
ACM2			Silk (AAB)	18°53´23”N, 104° 0´ 0” O	11
ACP1			Bluggoe (ABB)	18° 54´ 52”N, 103° 59´38” O	11
ACP2			Bluggoe (ABB)	18° 54´ 52”N, 103° 59´38” O	11
ACM3	Armería	Colima	Silk (AAB)	18°54´5”N, 103°54´31”O	11
ACM4			Silk (AAB)	18°54´5”N, 103°54´31”O	11
ACM10			Silk (AAB)	18°53´10”N, 103°59´37”O	11
ACP11			Bluggoe (ABB)	18°55´24”N, 103°57´49”O	11
ACP15			Bluggoe (ABB)	18°55´24”N, 103°57´49”O	11
ACM13			Silk (AAB)	18°55´34”N, 103°58´2”O	11
TCM1				18°55´3”N, 103°5´ 13´´O	40
TCM2				18°55´3”N, 103°5´ 13´´O	40
TCM8				18°48´44”N, 103°42´49” O	69
TCM9	Tecomán	Colima	Silk (AAB)	18°48´44”N, 103°42´49” O	69
TCM10				18°48´44”N, 103°42´49” O	69
TCM11				18°48´44”N, 103°42´49” O	69
TCM12				18°48´44”N, 103°42´49” O	69
TCM13				18°50´ 54´´N, 163°99´ 28´´ O	27
TCM14				18°50´ 54´´N, 163°99´ 28´´ O	27
TCM15				18°50´ 54´´N, 163°99´ 28´´ O	27
TCM16				18°50´ 54´´N, 163°99´ 28´´ O	27
TCM1				18°58´2”N, 103° 50´33” O	62
MCP1			Bluggoe (ABB)	18°57´0”N, 104°3´40”O	22
MCT3			Pisang awak (ABB)	109°02´48”N, 104°06´35”O	70
MCT4			Pisang awak (ABB)	109°02´48”N, 104°06´35”O	70
MCT5			Pisang awak (ABB)	109°02´48”N, 104°06´35”O	70
MCT6			Pisang awak (ABB)	109°02´48”N, 104°06´35”O	70
MCM7 MCM9	Manzanillo	Colima	Silk (AAB) Silk (AAB)	109°0´52”N, 104°9´22”O 109°0´52”N, 104°9´22”O	21 21
MCM10			Silk (AAB)	109°0´52”N, 104°9´22”O	21
MCM11			Silk (AAB)	109°0´52”N, 104°9´22”O	21
MCM13			Silk (AAB)	19°00´46”O, 104°09´25”O	21
MCM14			Silk (AAB)	19°00´46”O, 104°09´25”O	21
MCM15			Silk (AAB)	19°02´21”N, 104°14´08”O	16
SNM1			Silk (AAB)	21°32´25”N, 105°07´51”O	325
SNP1			Bluggoe (ABB)	21°32´32”N, 105°08´01”O	206
SNM2			Silk (AAB)	21°32´32”N, 105°08´05”O	206
SNM3			Silk (AAB)	21°32´32”N, 105°08´05”O	206
SNM4			Silk (AAB)	21°32´41”N, 105°08´05”O	206
SNM5			Silk (AAB)	21°32´44”N, 105°08´12”O	206
SNM5.2			Silk (AAB)	21°32´44”N, 105°08´12”O	206
SNM6			Silk (AAB)	21°32´44”N, 105°08´12”O	206
SNM7 SNM8	San Blas	Nayarit	Silk (AAB) Silk (AAB)	21°32´44”N, 105°08´12”O 21°32´44”N, 105°08´17”O	206 206
SNM9			Silk (AAB)	21°32´44”N, 105°08´17”O	206
SNM10			Pisang awak (ABB)	21°26´36”N, 105°11´20”O	33
SNT1			Pisang awak (ABB)	21°26´36”N, 105°11´20”O	33
SNT2			Pisang awak (ABB)	21°26´36”N, 105°11´20”O	33
SNT3			Pisang awak (ABB)	21°26´36”N, 105°11´20”O	33
SNT4			Pisang awak (ABB)	21°26´36”N, 105°11´20”O	33
SNT5			Pisang awak (ABB)	21°26´36”N, 105°11´20”O	33
SNT6			Pisang awak (ABB)	21°26´36”N, 105°11´20”O	33
AYP1			Bluggoe (ABB)	20°15´53”N, 89°21´37”O	32
AYP2 AYM1	Akil	Yucatán	Bluggoe (ABB) Silk (AAB)	20°5´55”N, 89°21´37”O 20°15´52”N, 89°2´37”O	32 32
AYM2			Silk (AAB)	20°15´52”N, 89°21´22”O	32
OYM4			Silk (AAB)	20°13´38”N, 89°27´32”O	49
OYM5 OYM6	Oxkutzcab	Yucatán	Silk (AAB) Silk (AAB)	20°13´38”N, 89°27´32”O 20°13´14”N, 89°26´30”O	49 49
OYM7			Silk (AAB)	20°13´38”N, 89°27´32”O	49
OYM8			Silk (AAB)	20°13´38”N, 89°27´32”O	49
OYM9			Silk (AAB)	20°13´38”N, 89°27´32”O	49
OYP3			Bluggoe (ABB)	20°13´38”N, 89°27´32”O	49
OYM10			Silk (AAB)	20°16´42”N, 89°22´52”O	32
OYM11			Silk (AAB)	20°16´42”N, 89°22´52”O	32
OYM12			Silk (AAB)	20°16´42”N, 89°22´52”O	32
OYM13			Silk (AAB)	20°16´42”N, 89°22´52”O	32
OYM14			Silk (AAB)	20°16´42”N, 89°22´52”O	32
CMM1				18°40´41”N, 103°40´29”O	21
CMM2				18°40´43”N, 103°40´31”O	21
CMM3				18°40´22”N, 103°41´22”O	29
CMM4				18°39´57”N, 103°41´27”O	29
CMM5	Coahuayana	Michoacán	Silk (AAB)	18°44´04”N, 103°40´01”O	27
CMM6				18°44´04”N, 103°40´01”O	27
CMM7				18°42´59”N, 103°42´03”O	27
CMM8				18°42´59”N, 103°42´03”O	27
CMM9				18°42´59”N, 103°42´03”O	27
RJP1			Silk (AAB)	19°10´30.42´´N 104°36´01.13´´O	12
RJP2			Silk (AAB)	19°10´30.22´´N, 104°36´01.25´´O	12
RJP3			Silk (AAB)	19°10´30.22´´N, 104°36´01.57´´O	12
RJP4			Silk (AAB)	19°10´30.04´´N, 104°36´01.74´´O	12
RJP5			Silk (AAB)	19°10´29.93´´N, 104°36´02.17´´O	12
RJP6			Silk (AAB)	19°10´29.83´´N 104°36´02.41´´O	12
RJP7			Silk (AAB)	19°10´39.42´´N 104°36´07.12´´O	12
RJP8			Silk (AAB)	19°10´38.67´´N 104°36´06.60´´O	12
RJP9			Silk (AAB)	19°10´38.38´´N 104°36´05.71´´O	12
RJP10 RJP11	El Rebalse	Jalisco	Silk (AAB) Bluggoe (ABB)	19°10´38.86´´N 104°36´07.77´´O 19°10´38.66´´N 104°36´06.80´´O	12 14
RJM12			Bluggoe (ABB)	19°10´39.20´´N 104°36´09.30´´O	14
RJM13			Bluggoe (ABB)	19°10´38.68´´N 104°36´09.20´´O	14
RJM14			Bluggoe (ABB)	19°11´15.86´´N, 104°35´29.56´´O	14
RJM15			Bluggoe (ABB)	19°11´16.26´´N, 104°35´29.50´´O	14
RJM16			Bluggoe (ABB)	19°11´17.05´´N, 104°35´17.05´´O	14
RJM17			Bluggoe (ABB)	19°11´17.35´´N, 104°35´27.92´´O	14
RJM18			Bluggoe (ABB)	19°11´17.72´´N, 104°35´26.70´´O	14
RJM19			Bluggoe (ABB)	19°11´21.94´´N, 104°35´09.52´´O	14
RJM20			Bluggoe (ABB)	19°11´21.83´´N, 104°35´08.53´´O	14

Table 2

Primer	xPrimer secuence (5´-3´)	Annealing temperature (°C)
G1/ MV15	R: CTCGTCCTTTGCGAATGACC	58
	G: ACCACCTCGGTGATGGTGAGACGG
	R: CAAGCCGCTCTCCACGGCGAAGGCG
MB18	F: GGTAGGAAATGACGAAGCTGAC	57
	R: TGAGCACTCTAGCACTCCAAAC
	R: CGTCCTCAAGAGCAGCGAC

x F: forward R: reverse

The total isolates were organized into three groups, to improve the robustness of the analysis and to facilitate data interpretation. Thus, we considered isolates form Colima, Jalisco and Michoacán as a single population because of their regional continuity and the lack of apparent ecological barriers. Isolates from Nayarit integrate the second population, and those from Yucatán are the third population. Later, based on geographical proximity and the banana fruit and propagule trading routes, these were further allocated into two regions: (i) East México (samples from Yucatán), and (ii) West México (isolates from Nayarit, Colima, Jalisco, and Michoacán). The number and frequency of haplotypes were calculated in POPGENE. With this data, using the dissimilarity index of Morisita in the R package vegan (Oksanen et al. 2019), the genetic similarity of the populations was estimated. With the haplotype data, we also conducted a molecular analysis of variance (AMOVA) to evaluate the genetic differentiation between regions (FCT), among populations in each region (FSC), and among all populations included in the analysis (FST). We performed the AMOVA in ARLEQUIN v. 3.5 using 1000 permutations. Additionally, to illustrate the relations among haplotypes, and their distribution and frequency among populations we generate a minimum spanning network. Genetic structure was inferred using the principal component analysis and the sparse non-negative matrix factorization (sNMF) in LEA (Frichot and François, 2015). We selected the preferred number of K using a cross-entropy criterion based on the prediction of masked genotypes to evaluate the error of ancestry estimation.

Results of cultural characterization showed that colony size development ranged from

8.7 to 9.8 mm per day on PDA medium at 28 °C. After seven days of culture, all isolates had cottony white mycelia, which can be flat to aerial, circular or irregular in shape, colored on the upper surfaces from light violet to dark violet. On the petri dish reverse, color colonies ranged from orange to dark red. Short monophialides had an average of 3-

5 septa, unicellular or bicellular, with oval microconidia of 5-15 × 2.5-3.5 μm. Macroconidia were 23.5-47.8 × 3.3-4.8 μm, falciform, with three to four septa (Leslie and Summerell, 2006). These characteristics were typical to Fusarium oxysporum. All tested loci were polymorphic across the 96 Mexican isolates of Fusarium oxysporum. We detect 16 haplotypes, of which the most frequent and common was the H16 (Figure 1). The rest were widely dispersed or restricted to one or two populations.

Figure 1

Genetic differences among the three analyzed populations were not significative (Table 3, Figure 2), nor at any comparison level (Table 4).

Table 3

Population	Colima, Jalisco and Michoacán	Nayarit	Yucatán
Colima, Jalisco and Michoacán	–	–	–
Nayarit	0.097	–	–
Yucatán	0.000	0.255	–

Figure 2

Table 4

Source of variationX	d.f.	Sum of squares	Variance components	Variation (%)	>FI	P
Between regions	1	0.921	-0.00145	-0.19	-0.00188	0.66960 ± 0.019
Between population within regions	1	1.012	0.00888	1.15	0.01150	0.21114 ± 0.014
Within populations	94	71.778	0.76359	99.04	0.00964	0.23460 ± 0.011
Total	96	73.711	0.77103	–	–	–

xd.f., degrees of freedom; FI, fixation index; P, significance.

According to these results, Mexican Fo populations are genetically similar (Tables 3 y 4). Magdama et al., (2020), also concluded that the populations of Foc in Ecuador comprise a single clonal lineage. In this work several Fo haplotypes were detected but only one was dominant (Figure 1). This may be related to the low variability rate of Fo as asexual organism compared to sexually reproducing organisms such as Pseudocercospora fijiensis (Manzo-Sánchez et al., 2019; McDonald and Linde, 2002). These results also agree with Bentley (1998), who detects only one Foc lineage in Mexican populations (lineage VIII). The same author describes that this lineage is unique in Central America, but he did not assign a vegetative compatibility groups (VCG) code. Ordoñez (2018) specifies that VCG 0124 found in México corresponds to the 0124/5/8/20 compatibility group complex, whose worldwide members had been identified withing the 1, 2, and 4 race. The Foc VCG found in México allows us to hypothesize that the pathogen in this country is a mixture between a native and introduced strains. If this is true, human activities are responsible for the dissemination of the clonal lineage.

The fungus Fusarium oxysporum f. sp. cubense is a genetically diverse pathogen with a cosmopolitan distribution. It is composed of four races, of which three infect plantains and bananas (Ploetz, 2015; Pegg et al., 2019; Martinez-de la Parte et al., 2024; Baruah et al., 2025). Also, more than 24 vegetative compatibility groups have been recognized (Koening et al., 1997; Ordoñez, 2018; Maryani et al., 2019), and at least nine lineages phylogenetically clustered in two clades have been detected (Bentley et al., 1998; Czislowski et al., 2018; O’Donnell et al., 1998; Pegg et al., 2019). Because Foc reproduces preferentially asexually, its genetic diversity is grouped in clonal lineages (Bentley et al., 1998; Pegg et al., 2019); this diversity can be enriched occasionally by parasexual events in which horizontal gene transfer can occur (Czislowski et al., 2018; Fourie et al., 2009; Ma et al., 2010; Vlaardingerbroek et al., 2016). Thus, the genetic structure of Foc (or the absence of it) corresponds to what is expected for an organism that preferentially reproduces asexually (McDonald and Linde, 2002). In fact, the genetic diversity of this pathogen (most VCG) is concentrated in its center of origin, and only a few VCG are scattered around the world (Bentley et al., 1998; Koening et al., 1997; Mostert et al., 2017), which can explain the absence of detectable genetic structure in the sampled populations.

Why Foc is diverse, and cosmopolitan worldwide, but locally may lack genetic structure? We found three possible explanations: one is that the pathogen had effectively spread because of the exchange of contaminated materials (rhizomes or leaf trash) (Ploetz, 2015). Another explanation is that it is a polyphyletic complex; thus, it is possible that native local strains parasitically converged to the introduction of Musa spp. (Gurr, 2011). The third possibility is that indeed Musa spp. may have dispersed together with some of the Foc clonal lineages which exchanged genetic information using parasexual or perhaps sexual mechanisms with local native linages (Ordoñez, 2018). In México it is not known the dispersal dynamics of Foc (Ordoñez, 2018), although Foc -mainly race 1- it is widely distributed in the territory.

In conclusion, cultural morphology of monosporic Foc isolates were consistent with what has been reported in the literature for Foc. Despite the haplotypes diversity found (16), H16 was the most frequent, while the remaining haplotypes may be either widely distributed or local, but with low frequency. No significant genetic differences were found among the studied populations or grouped by regions. Therefore, these results using six SSR markers suggest that the analyzed populations constitute a single metapopulation.